Result : EXP00963
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00963 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3557028 |
| Right | 3557177 |
| Strand | - |
| Nucleotide Sequence | GTGAATGGCCGTACTGGGATTGCAGGGGGGGCGGGGAGGCGTGGGGACAACAACCATCACCGCCGCATTAGCCTGGTCATTACAAATGTTGGGAGAAAATGTCCTGGTGGTCGATGCCTGCCCGGACAACTTGTTGCGCCTGTCATTTAA |
| Sequence | VNGRTGIAGGAGRRGDNNHHRRISLVITNVGRKCPGGRCLPGQLVAPVI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 49 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4438111 | 4438260 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3695840 | 3695989 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3664857 | 3665006 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3714148 | 3714297 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 4191457 | 4191609 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 3658669 | 3658821 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01270.19 | 0.6 | 3 | 5588.0 | same-strand | Glycosyl hydrolases family 8 |
| 2 | PF03170.15 | 1.0 | 5 | 3269.0 | same-strand | Bacterial cellulose synthase subunit |
| 3 | PF00535.28 | 1.0 | 5 | 604.0 | same-strand | Glycosyl transferase family 2 |
| 4 | PF13632.8 | 0.8 | 4 | 604 | same-strand | Glycosyl transferase family group 2 |
| 5 | PF13641.8 | 1.0 | 5 | 604.0 | same-strand | Glycosyltransferase like family 2 |
| 6 | PF07238.16 | 1.0 | 5 | 604.0 | same-strand | PilZ domain |
| 7 | PF13506.8 | 1.0 | 5 | 604.0 | same-strand | Glycosyl transferase family 21 |
| 8 | PF10945.10 | 0.8 | 4 | 8 | same-strand | Cellulose biosynthesis protein BcsR |
| 9 | PF10995.10 | 0.8 | 4 | 481 | opposite-strand | Cellulose biosynthesis GIL |
| 10 | PF11120.10 | 0.8 | 4 | 2037 | opposite-strand | Cellulose biosynthesis protein BcsF |
| 11 | PF11658.10 | 0.8 | 4 | 2225 | opposite-strand | Cellulose biosynthesis protein BcsG |
| 12 | PF13940.8 | 0.8 | 4 | 3991 | same-strand | Toxin Ldr, type I toxin-antitoxin system |
| 13 | PF05420.13 | 0.6 | 3 | 6667 | same-strand | Cellulose synthase operon protein C C-terminus (BCSC C) |
| 14 | PF14559.8 | 0.6 | 3 | 6667 | same-strand | Tetratricopeptide repeat |
| 15 | PF07719.19 | 0.6 | 3 | 6667 | same-strand | Tetratricopeptide repeat |
| 16 | PF13432.8 | 0.6 | 3 | 6667 | same-strand | Tetratricopeptide repeat |
| 17 | PF13181.8 | 0.6 | 3 | 6667 | same-strand | Tetratricopeptide repeat |
| 18 | PF00515.30 | 0.6 | 3 | 6667 | same-strand | Tetratricopeptide repeat |
| 19 | PF06564.14 | 0.8 | 4 | -134.5 | same-strand | Cellulose biosynthesis protein BcsQ |
| 20 | PF01656.25 | 0.8 | 4 | -134.5 | same-strand | CobQ/CobB/MinD/ParA nucleotide binding domain |
| 21 | PF13614.8 | 0.8 | 4 | -145.0 | same-strand | AAA domain |
++ More..