Result : EXP00960
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00960 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3638906 |
| Right | 3638986 |
| Strand | - |
| Nucleotide Sequence | ATGAGTTTTAAACGCACAGAAAGATCGCCCAGCGGACCATCGCCGTCGAGTAACGGTTCTACAGCATACTTCACCGCGTAA |
| Sequence | MSFKRTERSPSGPSPSSNGSTAYFTA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 20
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4516715 | 4516795 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3775778 | 3775858 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3741671 | 3741751 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 214670 | 214744 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 5 | 3689020 | 3689094 | - | NZ_CP067057.1 | Rahnella aceris |
| 6 | 122534 | 122608 | - | NZ_CP034036.1 | Brenneria nigrifluens DSM 30175 = ATCC 13028 |
| 7 | 3498914 | 3498988 | + | NZ_CP034035.1 | Brenneria rubrifaciens |
| 8 | 4409236 | 4409310 | - | NZ_CP014137.1 | Brenneria goodwinii |
| 9 | 3864125 | 3864199 | + | NZ_CP023009.1 | Lonsdalea britannica |
| 10 | 2322772 | 2322846 | - | NZ_CP011078.1 | Yersinia ruckeri |
| 11 | 2675294 | 2675368 | + | NZ_CP065534.1 | Lonsdalea populi |
| 12 | 572232 | 572321 | + | NZ_CP050851.1 | Aeromonas hydrophila |
| 13 | 2914567 | 2914656 | - | NZ_CP065745.1 | Aeromonas allosaccharophila |
| 14 | 2652635 | 2652724 | - | NZ_CP044060.1 | Aeromonas veronii |
| 15 | 478029 | 478118 | + | NZ_LR134376.1 | Aeromonas encheleia |
| 16 | 2992153 | 2992227 | - | NZ_CP012621.1 | Zobellella denitrificans |
| 17 | 2524781 | 2524861 | - | NZ_CP033744.1 | Citrobacter freundii |
| 18 | 1241838 | 1241912 | + | NC_008709.1 | Psychromonas ingrahamii 37 |
| 19 | 132618 | 132707 | - | NZ_AP018724.1 | Sulfurivermis fontis |
| 20 | 1812651 | 1812731 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 21 | 99475 | 99555 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00359.24 | 0.9 | 18 | 1471 | opposite-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
| 2 | PF02378.20 | 0.95 | 19 | 1466.5 | opposite-strand | Phosphotransferase system, EIIC |
| 3 | PF02302.19 | 0.95 | 19 | 1466.5 | opposite-strand | PTS system, Lactose/Cellobiose specific IIB subunit |
| 4 | PF08125.15 | 0.9 | 18 | 246 | opposite-strand | Mannitol dehydrogenase C-terminal domain |
| 5 | PF01232.25 | 0.9 | 18 | 246 | opposite-strand | Mannitol dehydrogenase Rossmann domain |
| 6 | PF05068.14 | 0.95 | 19 | -77.0 | opposite-strand | Mannitol repressor |
++ More..