Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00954 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 927232 |
Right | 927273 |
Strand | - |
Nucleotide Sequence | GTGGTTCAACAATGCCAAAGGGTTTGGTTTCATCTGCCCTGA |
Sequence | VVQQCQRVWFHLP |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 13 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1053605 | 1053646 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 1339428 | 1339469 | + | NZ_CP045300.1 | Kosakonia arachidis |
3 | 1021965 | 1022006 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
4 | 2039911 | 2039952 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
5 | 947730 | 947771 | - | NZ_AP014857.1 | Escherichia albertii |
6 | 922529 | 922570 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
7 | 873842 | 873883 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
8 | 3456928 | 3456969 | - | NZ_CP053416.1 | Salmonella bongori |
9 | 1571502 | 1571543 | - | NZ_LR134340.1 | Escherichia marmotae |
10 | 1419333 | 1419374 | - | NZ_CP061527.1 | Shigella dysenteriae |
11 | 3811308 | 3811349 | + | NZ_CP050508.1 | Raoultella terrigena |
12 | 1527681 | 1527722 | + | NZ_CP051180.1 | Ferrimonas lipolytica |
13 | 3183288 | 3183329 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
14 | 978708 | 978749 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
15 | 3458949 | 3458990 | + | NZ_LR134475.1 | Klebsiella aerogenes |
16 | 1783036 | 1783077 | - | NZ_CP043727.1 | Yersinia canariae |
17 | 1908422 | 1908463 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
18 | 1650468 | 1650509 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
19 | 3904652 | 3904693 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
20 | 4072724 | 4072765 | + | NZ_CP060111.1 | Klebsiella michiganensis |
21 | 3675856 | 3675897 | + | NZ_CP054254.1 | Klebsiella variicola |
22 | 1846231 | 1846272 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
23 | 3526903 | 3526944 | + | NZ_CP041247.1 | Raoultella electrica |
24 | 3422373 | 3422414 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
25 | 3449352 | 3449396 | + | NZ_CP011930.1 | Herbaspirillum seropedicae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF11398.10 | 0.92 | 22 | 4397 | opposite-strand | Protein of unknown function (DUF2813) |
2 | PF16576.7 | 0.92 | 22 | 2179 | opposite-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
3 | PF13437.8 | 0.92 | 22 | 2179.0 | opposite-strand | HlyD family secretion protein |
4 | PF13533.8 | 0.92 | 22 | 2179 | opposite-strand | Biotin-lipoyl like |
5 | PF12704.9 | 0.92 | 22 | 236 | opposite-strand | MacB-like periplasmic core domain |
6 | PF00005.29 | 0.96 | 23 | 237.5 | opposite-strand | ABC transporter |
7 | PF02687.23 | 0.92 | 22 | 236 | opposite-strand | FtsX-like permease family |
8 | PF00313.24 | 1.0 | 24 | -41 | same-strand | 'Cold-shock' DNA-binding domain |
9 | PF02617.19 | 0.96 | 23 | 344.0 | opposite-strand | ATP-dependent Clp protease adaptor protein ClpS |
10 | PF07724.16 | 0.96 | 23 | 694.0 | opposite-strand | AAA domain (Cdc48 subfamily) |
11 | PF17871.3 | 0.96 | 23 | 694.0 | opposite-strand | AAA lid domain |
12 | PF10431.11 | 0.96 | 23 | 694.0 | opposite-strand | C-terminal, D2-small domain, of ClpB protein |
13 | PF00004.31 | 0.96 | 23 | 694.0 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
14 | PF07728.16 | 0.96 | 23 | 694.0 | opposite-strand | AAA domain (dynein-related subfamily) |
15 | PF02861.22 | 0.96 | 23 | 694.0 | opposite-strand | Clp amino terminal domain, pathogenicity island component |
16 | PF05621.13 | 0.96 | 23 | 694.0 | opposite-strand | Bacterial TniB protein |
17 | PF01176.21 | 0.71 | 17 | 3450.5 | same-strand | Translation initiation factor 1A / IF-1 |
18 | PF03588.16 | 0.62 | 15 | 3821.0 | same-strand | Leucyl/phenylalanyl-tRNA protein transferase |