Result : EXP00953
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00953 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3821055 |
| Right | 3821093 |
| Strand | - |
| Nucleotide Sequence | ATGCGCATCGGCGACAAATATCCCAGACGTACCGCCTGA |
| Sequence | MRIGDKYPRRTA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4725823 | 4725861 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3932254 | 3932292 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3940958 | 3940996 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 4259033 | 4259071 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2707432 | 2707470 | - | NZ_CP033744.1 | Citrobacter freundii |
| 6 | 2840587 | 2840625 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 3899141 | 3899179 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 5403675 | 5403713 | + | NC_015567.1 | Serratia plymuthica AS9 |
| 9 | 3389425 | 3389463 | + | NZ_CP038469.1 | Citrobacter tructae |
| 10 | 4057412 | 4057450 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 11 | 2382820 | 2382861 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 12 | 494117 | 494155 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 13 | 3198816 | 3198854 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 14 | 4594922 | 4594960 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 15 | 4341352 | 4341390 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 16 | 1186826 | 1186867 | + | NZ_CP040428.1 | Jejubacter calystegiae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01037.23 | 0.87 | 13 | 5251.5 | same-strand | Lrp/AsnC ligand binding domain |
| 2 | PF13412.8 | 0.87 | 13 | 5251.5 | same-strand | Winged helix-turn-helix DNA-binding |
| 3 | PF13404.8 | 0.87 | 13 | 5251.5 | same-strand | AsnC-type helix-turn-helix domain |
| 4 | PF03590.17 | 1.0 | 15 | 4107.5 | opposite-strand | Aspartate-ammonia ligase |
| 5 | PF13519.8 | 1.0 | 15 | 2653.0 | same-strand | von Willebrand factor type A domain |
| 6 | PF20030.1 | 1.0 | 15 | 1161.0 | same-strand | MoxR domain in the MoxR-vWA-beta-propeller ternary systems |
| 7 | PF07728.16 | 1.0 | 15 | 1161.0 | same-strand | AAA domain (dynein-related subfamily) |
| 8 | PF12592.10 | 1.0 | 15 | 1161.0 | same-strand | Protein of unknown function (DUF3763) |
| 9 | PF17868.3 | 1.0 | 15 | 1161.0 | same-strand | AAA lid domain |
| 10 | PF07726.13 | 0.67 | 10 | 1161 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 11 | PF02705.18 | 1.0 | 15 | -38.0 | opposite-strand | K+ potassium transporter |
| 12 | PF05025.15 | 0.93 | 14 | 1078 | opposite-strand | RbsD / FucU transport protein family |
| 13 | PF00005.29 | 1.0 | 15 | 1507.0 | opposite-strand | ABC transporter |
| 14 | PF02653.18 | 0.87 | 13 | 3019.0 | opposite-strand | Branched-chain amino acid transport system / permease component |
| 15 | PF13407.8 | 0.8 | 12 | 4009 | opposite-strand | Periplasmic binding protein domain |
| 16 | PF00532.23 | 0.8 | 12 | 4009 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
++ More..