Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00952 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 2315774 |
Right | 2315851 |
Strand | - |
Nucleotide Sequence | GTGCCAGCGGCGCGATTTATGGCGTGCGCTTATTACAGGTTCTGCGCGATGTCACAGATATCGAAACGCATCTGGTGA |
Sequence | VPAARFMACAYYRFCAMSQISKRIW |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 25 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2428521 | 2428598 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 2436632 | 2436709 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
3 | 4370131 | 4370208 | + | NZ_CP057657.1 | Escherichia fergusonii |
4 | 1296783 | 1296860 | + | NZ_CP061527.1 | Shigella dysenteriae |
5 | 3154826 | 3154903 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
6 | 437854 | 437931 | - | NZ_CP053416.1 | Salmonella bongori |
7 | 2972204 | 2972281 | - | NZ_LR134340.1 | Escherichia marmotae |
8 | 2429940 | 2430017 | - | NZ_AP014857.1 | Escherichia albertii |
9 | 2948734 | 2948811 | - | NZ_CP016948.1 | Serratia surfactantfaciens |
10 | 2555905 | 2555985 | - | NZ_CP017279.1 | Enterobacter ludwigii |
11 | 3293544 | 3293621 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
12 | 3990050 | 3990139 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
13 | 2791915 | 2791992 | + | NZ_CP054043.1 | Yersinia mollaretii ATCC 43969 |
14 | 2053240 | 2053317 | - | NZ_CP023529.1 | Lelliottia amnigena |
15 | 4653072 | 4653146 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
16 | 125425 | 125493 | + | NZ_CP038469.1 | Citrobacter tructae |
17 | 3298222 | 3298296 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
18 | 1535508 | 1535573 | + | NZ_CP050508.1 | Raoultella terrigena |
19 | 3577917 | 3578006 | - | NZ_CP043318.1 | Enterobacter chengduensis |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00528.24 | 1.0 | 18 | 2671.0 | same-strand | Binding-protein-dependent transport system inner membrane component |
2 | PF00497.22 | 1.0 | 18 | 775.5 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
3 | PF13522.8 | 0.94 | 17 | 123.0 | same-strand | Glutamine amidotransferase domain |
4 | PF13537.8 | 0.94 | 17 | 123.0 | same-strand | Glutamine amidotransferase domain |
5 | PF02674.18 | 0.94 | 17 | 1677.0 | same-strand | Colicin V production protein |
6 | PF05036.15 | 0.94 | 17 | 2424.0 | same-strand | SPOR domain |
7 | PF17848.3 | 0.67 | 12 | 4414 | same-strand | Acetyl-coA carboxylase zinc finger domain |