Result : EXP00951
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00951 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2106860 |
| Right | 2106907 |
| Strand | - |
| Nucleotide Sequence | TTGTCCGGACATTGTTTTGTCGTCATTCCTCAATGGCCTGATTTATGA |
| Sequence | LSGHCFVVIPQWPDL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2893124 | 2893171 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2211997 | 2212044 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2222986 | 2223033 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1636328 | 1636375 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2759021 | 2759068 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06998.13 | 1.0 | 4 | 313 | opposite-strand | Protein of unknown function (DUF1307) |
| 2 | PF07308.15 | 1.0 | 4 | -47 | same-strand | Protein of unknown function (DUF1456) |
| 3 | PF00072.26 | 1.0 | 4 | 199 | same-strand | Response regulator receiver domain |
| 4 | PF04397.17 | 1.0 | 4 | 199 | same-strand | LytTr DNA-binding domain |
| 5 | PF07694.14 | 1.0 | 4 | 915 | same-strand | 5TMR of 5TMR-LYT |
| 6 | PF06580.15 | 1.0 | 4 | 915 | same-strand | Histidine kinase |
| 7 | PF13185.8 | 1.0 | 4 | 915 | same-strand | GAF domain |
| 8 | PF13492.8 | 1.0 | 4 | 915 | same-strand | GAF domain |
| 9 | PF15714.7 | 1.0 | 4 | 915.0 | same-strand | Stage V sporulation protein T C-terminal, transcription factor |
| 10 | PF13411.8 | 0.75 | 3 | 2822 | opposite-strand | MerR HTH family regulatory protein |
| 11 | PF00376.25 | 0.75 | 3 | 2822 | opposite-strand | MerR family regulatory protein |
| 12 | PF00528.24 | 0.75 | 3 | 3701 | same-strand | Binding-protein-dependent transport system inner membrane component |
++ More..