Result : EXP00950
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00950 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3116514 |
| Right | 3116756 |
| Strand | - |
| Nucleotide Sequence | ATGATTGTTAGCAAGGAAAACTGTCAAAAATCTTCAAAAAATTTGATGGGTAAGGCCGGAATGGCTCCGGCCAGAGGGAAGTTAACCGCGAAGCTGTTGCTGCTTGAGGGTCGTTTTAACCAGACGCCAGGCGCTCCATACGCCAAAACCGCGTCTGGCCCAGCGGACCAGCATATTAGGATGGCGAATCGTCCAGATCGCCATCACGCTACTGCCAACCAGCGCCCAGGAGCGCAGACTTAG |
| Sequence | MIVSKENCQKSSKNLMGKAGMAPARGKLTAKLLLLEGRFNQTPGAPYAKTASGPADQHIRMANRPDRHHATANQRPGAQT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 80 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3989975 | 3990217 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3250215 | 3250457 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3242178 | 3242420 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2059495 | 2059704 | - | NZ_CP033744.1 | Citrobacter freundii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP033744.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13721.8 | 1.0 | 3 | 1393.0 | opposite-strand | SecD export protein N-terminal TM region |
| 2 | PF06476.14 | 1.0 | 3 | 878.0 | opposite-strand | Protein of unknown function (DUF1090) |
| 3 | PF19029.2 | 1.0 | 3 | 535.0 | opposite-strand | DUF883 C-terminal glycine zipper region |
| 4 | PF05957.15 | 1.0 | 3 | 535.0 | opposite-strand | DUF883 N-terminal domain |
| 5 | PF07332.13 | 1.0 | 3 | 128.0 | opposite-strand | Putative Actinobacterial Holin-X, holin superfamily III |
| 6 | PF13997.8 | 1.0 | 3 | -161.0 | opposite-strand | YqjK-like protein |
| 7 | PF07681.14 | 0.67 | 2 | 15 | opposite-strand | DoxX |
| 8 | PF13409.8 | 1.0 | 3 | 567.0 | opposite-strand | Glutathione S-transferase, N-terminal domain |
| 9 | PF13410.8 | 1.0 | 3 | 567.0 | opposite-strand | Glutathione S-transferase, C-terminal domain |
| 10 | PF05656.16 | 1.0 | 3 | 2133.5 | opposite-strand | Protein of unknown function (DUF805) |
| 11 | PF03466.22 | 1.0 | 3 | 2859.5 | same-strand | LysR substrate binding domain |
| 12 | PF00126.29 | 1.0 | 3 | 2859.5 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 13 | PF02678.18 | 0.67 | 2 | 3611.0 | opposite-strand | Pirin |
| 14 | PF17954.3 | 0.67 | 2 | 3611.0 | opposite-strand | Quercetinase C-terminal cupin domain |
++ More..