Result : EXP00935
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00935 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3216735 |
| Right | 3216770 |
| Strand | - |
| Nucleotide Sequence | TTGAAGGGAGTTGTATGTCAAAGTGATGAAGATTAA |
| Sequence | LKGVVCQSDED |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4090716 | 4090751 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3348235 | 3348270 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3340403 | 3340438 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 468600 | 468635 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04552.15 | 1.0 | 3 | 2085.0 | opposite-strand | Sigma-54, DNA binding domain |
| 2 | PF04963.15 | 1.0 | 3 | 2085.0 | opposite-strand | Sigma-54 factor, core binding domain |
| 3 | PF00309.22 | 1.0 | 3 | 2085.0 | opposite-strand | Sigma-54 factor, Activator interacting domain (AID) |
| 4 | PF02482.21 | 1.0 | 3 | 1775.0 | opposite-strand | Sigma 54 modulation protein / S30EA ribosomal protein |
| 5 | PF00359.24 | 1.0 | 3 | 1166.0 | opposite-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
| 6 | PF03668.17 | 1.0 | 3 | 266.0 | opposite-strand | P-loop ATPase protein family |
| 7 | PF00381.21 | 1.0 | 3 | -3.0 | opposite-strand | PTS HPr component phosphorylation site |
| 8 | PF10707.11 | 1.0 | 3 | 182.0 | opposite-strand | PhoP regulatory network protein YrbL |
| 9 | PF00912.24 | 0.67 | 2 | 811 | same-strand | Transglycosylase |
| 10 | PF02518.28 | 1.0 | 3 | 2419.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 11 | PF18415.3 | 1.0 | 3 | 2419.0 | same-strand | Histidine kinase receptor ArcB trans-membrane domain |
| 12 | PF00072.26 | 1.0 | 3 | 2419.0 | same-strand | Response regulator receiver domain |
| 13 | PF00989.27 | 1.0 | 3 | 2419.0 | same-strand | PAS fold |
| 14 | PF00512.27 | 1.0 | 3 | 2419.0 | same-strand | His Kinase A (phospho-acceptor) domain |
| 15 | PF08448.12 | 1.0 | 3 | 2419.0 | same-strand | PAS fold |
| 16 | PF01627.25 | 1.0 | 3 | 2419.0 | same-strand | Hpt domain |
| 17 | PF13426.9 | 1.0 | 3 | 2419.0 | same-strand | PAS domain |
| 18 | PF16199.7 | 1.0 | 3 | 4851.0 | same-strand | Radical SAM C-terminal domain |
| 19 | PF04055.23 | 1.0 | 3 | 4851.0 | same-strand | Radical SAM superfamily |
++ More..