Result : EXP00934
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00934 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2905433 |
| Right | 2905480 |
| Strand | - |
| Nucleotide Sequence | ATGTACATAAACCGTTGCTGCACATGTTGGCGGCCTTACAGACGGTAA |
| Sequence | MYINRCCTCWRPYRR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3074575 | 3074622 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3556347 | 3556394 | - | NZ_LR134340.1 | Escherichia marmotae |
| 3 | 3011953 | 3012000 | - | NZ_AP014857.1 | Escherichia albertii |
| 4 | 1961766 | 1961813 | - | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01116.22 | 0.75 | 3 | 3331 | same-strand | Fructose-bisphosphate aldolase class-II |
| 2 | PF00162.21 | 0.75 | 3 | 1953 | same-strand | Phosphoglycerate kinase |
| 3 | PF02800.22 | 0.75 | 3 | 884 | same-strand | Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain |
| 4 | PF00044.26 | 0.75 | 3 | 884 | same-strand | Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain |
| 5 | PF05068.14 | 1.0 | 4 | 64.0 | same-strand | Mannitol repressor |
| 6 | PF03320.15 | 1.0 | 4 | 595.0 | same-strand | Bacterial fructose-1,6-bisphosphatase, glpX-encoded |
| 7 | PF00107.28 | 1.0 | 4 | 1557.0 | same-strand | Zinc-binding dehydrogenase |
| 8 | PF02378.20 | 1.0 | 4 | 2849.0 | same-strand | Phosphotransferase system, EIIC |
| 9 | PF02302.19 | 1.0 | 4 | 2849.0 | same-strand | PTS system, Lactose/Cellobiose specific IIB subunit |
| 10 | PF00359.24 | 1.0 | 4 | 4265.0 | same-strand | Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 |
++ More..