Result : EXP00933
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00933 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 144729 |
| Right | 144809 |
| Strand | - |
| Nucleotide Sequence | ATGCCATGCCGGATGCAACACATCCGGCAACTTCACACTTACTCGTCCAGCAGAATCACTTTGCCGATATACGGCAGATGA |
| Sequence | MPCRMQHIRQLHTYSSSRITLPIYGR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 146298 | 146378 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 141925 | 142005 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 140016 | 140096 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3581873 | 3581953 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3697082 | 3697156 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 765009 | 765077 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 141443 | 141517 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 3948606 | 3948692 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 9 | 5798959 | 5799042 | + | NZ_CP009285.1 | Paenibacillus borealis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01564.19 | 0.75 | 6 | 5358 | same-strand | Spermine/spermidine synthase domain |
| 2 | PF17284.4 | 0.75 | 6 | 5358 | same-strand | Spermidine synthase tetramerisation domain |
| 3 | PF13649.8 | 0.75 | 6 | 5358 | same-strand | Methyltransferase domain |
| 4 | PF07732.17 | 0.88 | 7 | 3237.5 | opposite-strand | Multicopper oxidase |
| 5 | PF07731.16 | 0.88 | 7 | 3237.5 | opposite-strand | Multicopper oxidase |
| 6 | PF10518.11 | 0.75 | 6 | 3286 | opposite-strand | TAT (twin-arginine translocation) pathway signal sequence |
| 7 | PF01011.23 | 0.75 | 6 | 701.0 | same-strand | PQQ enzyme repeat |
| 8 | PF00156.29 | 0.88 | 7 | -42.0 | opposite-strand | Phosphoribosyl transferase domain |
| 9 | PF00484.21 | 0.88 | 7 | 9.0 | same-strand | Carbonic anhydrase |
| 10 | PF00005.29 | 0.88 | 7 | 780.0 | opposite-strand | ABC transporter |
| 11 | PF01061.26 | 0.88 | 7 | 1704.5 | opposite-strand | ABC-2 type transporter |
| 12 | PF03610.18 | 0.88 | 7 | 2577.0 | opposite-strand | PTS system fructose IIA component |
| 13 | PF01522.23 | 0.75 | 6 | 3081 | opposite-strand | Polysaccharide deacetylase |
++ More..