Result : EXP00930
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00930 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2313525 |
| Right | 2313596 |
| Strand | - |
| Nucleotide Sequence | ATGAACATTGGGCACCAAAAGGCATTGAAATCGTCTCGTATCAGGGGCAGGACAACATTTATTCTGACCTGA |
| Sequence | MNIGHQKALKSSRIRGRTTFILT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3152577 | 3152648 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2426272 | 2426343 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2434383 | 2434454 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 4650770 | 4650847 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 5 | 2188514 | 2188591 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 6 | 2464756 | 2464827 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 7 | 2969957 | 2970034 | - | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 1721945 | 1722016 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 1.0 | 7 | 1763.5 | same-strand | ABC transporter |
| 2 | PF02463.21 | 1.0 | 7 | 1763.5 | same-strand | RecF/RecN/SMC N terminal domain |
| 3 | PF00528.24 | 1.0 | 7 | 735.5 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 4 | PF00497.22 | 1.0 | 7 | 294.0 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 5 | PF13522.8 | 0.71 | 5 | 2378.0 | same-strand | Glutamine amidotransferase domain |
| 6 | PF13537.8 | 0.71 | 5 | 2378.0 | same-strand | Glutamine amidotransferase domain |
| 7 | PF02674.18 | 0.71 | 5 | 3932.0 | same-strand | Colicin V production protein |
++ More..