Result : EXP00924
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00924 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4386054 |
| Right | 4386125 |
| Strand | - |
| Nucleotide Sequence | ATGAATACCTTCAAGAACCATACAGCCAGCGCAGCCGCCGTTTTGGCTATATCTGCGCGCCGCTTCTTTTAA |
| Sequence | MNTFKNHTASAAAVLAISARRFF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4474412 | 4474483 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4412633 | 4412704 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 5330077 | 5330148 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 3986123 | 3986194 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01948.20 | 1.0 | 3 | 2965.0 | same-strand | Aspartate carbamoyltransferase regulatory chain, allosteric domain |
| 2 | PF02748.17 | 1.0 | 3 | 2965.0 | same-strand | Aspartate carbamoyltransferase regulatory chain, metal binding domain |
| 3 | PF02729.23 | 1.0 | 3 | 2018 | same-strand | Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain |
| 4 | PF00185.26 | 1.0 | 3 | 2018 | same-strand | Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain |
| 5 | PF01042.23 | 1.0 | 3 | 1203.5 | same-strand | Endoribonuclease L-PSP |
| 6 | PF13561.8 | 1.0 | 3 | 359.0 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 7 | PF00106.27 | 1.0 | 3 | 359.0 | same-strand | short chain dehydrogenase |
| 8 | PF00440.25 | 1.0 | 3 | -71.0 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 9 | PF04074.14 | 1.0 | 3 | 379.0 | opposite-strand | YhcH/YjgK/YiaL |
| 10 | PF03400.15 | 0.67 | 2 | 1492.5 | both-strands | IS1 transposase |
++ More..