Result : EXP00923
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00923 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1170689 |
| Right | 1170733 |
| Strand | - |
| Nucleotide Sequence | TTGTTATACTTTGTTATTCAAAATCAGTTGCCCATTACTATCTAG |
| Sequence | LLYFVIQNQLPITI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1527362 | 1527406 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1155839 | 1155883 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 1749137 | 1749181 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1168097 | 1168141 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01636.25 | 1.0 | 3 | 4033.0 | opposite-strand | Phosphotransferase enzyme family |
| 2 | PF00933.23 | 1.0 | 3 | 2997.0 | opposite-strand | Glycosyl hydrolase family 3 N terminal domain |
| 3 | PF05728.14 | 1.0 | 3 | 2432.0 | opposite-strand | Uncharacterised protein family (UPF0227) |
| 4 | PF07992.16 | 1.0 | 3 | 725.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 5 | PF00070.29 | 1.0 | 3 | 725.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 6 | PF05433.17 | 1.0 | 3 | -41.0 | opposite-strand | Glycine zipper 2TM domain |
| 7 | PF13441.8 | 1.0 | 3 | -41.0 | opposite-strand | YMGG-like Gly-zipper |
| 8 | PF13488.8 | 1.0 | 3 | -41.0 | opposite-strand | Glycine zipper |
| 9 | PF00440.25 | 1.0 | 3 | 59.0 | same-strand | Bacterial regulatory proteins, tetR family |
| 10 | PF07338.15 | 1.0 | 3 | 932.0 | opposite-strand | Protein of unknown function (DUF1471) |
| 11 | PF17969.3 | 1.0 | 3 | 1271.5 | same-strand | L,D-transpeptidase C-terminal domain |
| 12 | PF03734.16 | 1.0 | 3 | 1271.5 | same-strand | L,D-transpeptidase catalytic domain |
| 13 | PF01476.22 | 1.0 | 3 | 1271.5 | same-strand | LysM domain |
| 14 | PF03461.17 | 1.0 | 3 | 2376.5 | same-strand | TRCF domain |
| 15 | PF17757.3 | 1.0 | 3 | 2376.5 | same-strand | UvrB interaction domain |
| 16 | PF02559.18 | 1.0 | 3 | 2376.5 | same-strand | CarD-like/TRCF domain |
| 17 | PF00270.31 | 1.0 | 3 | 2376.5 | same-strand | DEAD/DEAH box helicase |
| 18 | PF00271.33 | 1.0 | 3 | 2376.5 | same-strand | Helicase conserved C-terminal domain |
| 19 | PF04851.17 | 1.0 | 3 | 2376.5 | same-strand | Type III restriction enzyme, res subunit |
| 20 | PF01757.24 | 1.0 | 3 | 5950.5 | same-strand | Acyltransferase family |
++ More..