Result : EXP00922
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00922 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4107510 |
| Right | 4107557 |
| Strand | - |
| Nucleotide Sequence | ATGTTGAGTTCTCAAATACGGAAATTATCCGCAGTTTACCTGAATTAG |
| Sequence | MLSSQIRKLSAVYLN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5008410 | 5008457 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 4170910 | 4170957 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 4199458 | 4199505 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 4218439 | 4218486 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 3141571 | 3141618 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 238426 | 238473 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 132729 | 132776 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01964.20 | 1.0 | 6 | 3359 | same-strand | Radical SAM ThiC family |
| 2 | PF13667.8 | 1.0 | 6 | 3359 | same-strand | ThiC-associated domain |
| 3 | PF04353.15 | 1.0 | 6 | 2650 | same-strand | Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ |
| 4 | PF00293.30 | 1.0 | 6 | 1782 | opposite-strand | NUDIX domain |
| 5 | PF09297.13 | 1.0 | 6 | 1782 | opposite-strand | NADH pyrophosphatase zinc ribbon domain |
| 6 | PF01208.19 | 1.0 | 6 | 678 | opposite-strand | Uroporphyrinogen decarboxylase (URO-D) |
| 7 | PF04493.16 | 1.0 | 6 | -3 | opposite-strand | Endonuclease V |
| 8 | PF04222.14 | 1.0 | 6 | -1 | opposite-strand | Protein of unknown function (DUF416) |
| 9 | PF00216.23 | 1.0 | 6 | 776 | opposite-strand | Bacterial DNA-binding protein |
| 10 | PF07356.14 | 1.0 | 6 | 1121 | opposite-strand | Protein of unknown function (DUF1481) |
| 11 | PF13801.8 | 1.0 | 6 | 1758 | same-strand | Heavy-metal resistance |
| 12 | PF02518.28 | 0.83 | 5 | 2417 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 13 | PF00512.27 | 0.83 | 5 | 2417 | opposite-strand | His Kinase A (phospho-acceptor) domain |
| 14 | PF14501.8 | 0.67 | 4 | 2419.0 | opposite-strand | GHKL domain |
++ More..