Result : EXP00918
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00918 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3349733 |
| Right | 3349792 |
| Strand | - |
| Nucleotide Sequence | GTGATCATGAGATGGCAATTGAACAAACAGCAATTACACGCGCGACTTTCGATGAAGTGA |
| Sequence | VIMRWQLNKQQLHARLSMK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 8
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3490132 | 3490191 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3459341 | 3459400 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 4210166 | 4210225 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2396329 | 2396388 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 5 | 3978250 | 3978309 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 350290 | 350349 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 3451079 | 3451138 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 2280767 | 2280826 | - | NZ_CP033744.1 | Citrobacter freundii |
| 9 | 2793953 | 2794012 | + | NZ_CP044098.1 | Citrobacter portucalensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00485.20 | 0.88 | 7 | 4801.5 | opposite-strand | Phosphoribulokinase / Uridine kinase family |
| 2 | PF02566.21 | 1.0 | 8 | 4328 | same-strand | OsmC-like protein |
| 3 | PF00027.31 | 1.0 | 8 | 3391 | opposite-strand | Cyclic nucleotide-binding domain |
| 4 | PF13545.8 | 1.0 | 8 | 3391 | opposite-strand | Crp-like helix-turn-helix domain |
| 5 | PF00325.22 | 1.0 | 8 | 3391 | opposite-strand | Bacterial regulatory proteins, crp family |
| 6 | PF12805.9 | 1.0 | 8 | 1250 | opposite-strand | FUSC-like inner membrane protein yccS |
| 7 | PF13515.8 | 1.0 | 8 | 1250 | opposite-strand | Fusaric acid resistance protein-like |
| 8 | PF00202.23 | 1.0 | 8 | -48 | same-strand | Aminotransferase class-III |
| 9 | PF00117.30 | 1.0 | 8 | 75 | same-strand | Glutamine amidotransferase class-I |
| 10 | PF02661.20 | 1.0 | 8 | 670 | same-strand | Fic/DOC family |
| 11 | PF10832.10 | 1.0 | 8 | 1262 | same-strand | Protein of unknown function (DUF2559) |
| 12 | PF00160.23 | 1.0 | 8 | 1534 | same-strand | Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD |
| 13 | PF07690.18 | 0.88 | 7 | 2375.0 | opposite-strand | Major Facilitator Superfamily |
++ More..