Result : EXP00913
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00913 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3185836 |
| Right | 3185910 |
| Strand | - |
| Nucleotide Sequence | ATGAACAAGAGATCGACGTCCGCGTACAGATCGATCGCAAAAGCGGTGATTTTGACACCTTCCGTCGCTGGTTAG |
| Sequence | MNKRSTSAYRSIAKAVILTPSVAG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4059963 | 4060037 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 499996 | 500070 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 3823528 | 3823602 | - | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 3317337 | 3317411 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 3309519 | 3309593 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 6 | 4918791 | 4918865 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 424690 | 424764 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 8 | 448945 | 449019 | + | NZ_FO704550.1 | Xenorhabdus doucetiae |
| 9 | 3332628 | 3332702 | - | NZ_FO704551.1 | Xenorhabdus poinarii G6 |
| 10 | 289471 | 289545 | + | NZ_CP035688.1 | Vibrio metoecus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00312.24 | 1.0 | 9 | 5653.0 | same-strand | Ribosomal protein S15 |
| 2 | PF01509.20 | 1.0 | 9 | 4560.0 | same-strand | TruB family pseudouridylate synthase (N terminal domain) |
| 3 | PF16198.7 | 1.0 | 9 | 4560.0 | same-strand | tRNA pseudouridylate synthase B C-terminal domain |
| 4 | PF09157.13 | 1.0 | 9 | 4560.0 | same-strand | Pseudouridine synthase II TruB, C-terminal |
| 5 | PF02033.20 | 1.0 | 9 | 4159.0 | same-strand | Ribosome-binding factor A |
| 6 | PF11987.10 | 1.0 | 9 | 1323.0 | same-strand | Translation-initiation factor 2 |
| 7 | PF00009.29 | 1.0 | 9 | 1323.0 | same-strand | Elongation factor Tu GTP binding domain |
| 8 | PF04760.17 | 1.0 | 9 | 1323.0 | same-strand | Translation initiation factor IF-2, N-terminal region |
| 9 | PF08364.13 | 1.0 | 9 | 1323.0 | same-strand | Bacterial translation initiation factor IF-2 associated region |
| 10 | PF03144.27 | 1.0 | 9 | 1323.0 | same-strand | Elongation factor Tu domain 2 |
| 11 | PF01926.25 | 1.0 | 9 | 1323.0 | same-strand | 50S ribosome-binding GTPase |
| 12 | PF00025.23 | 0.89 | 8 | 1323 | same-strand | ADP-ribosylation factor family |
| 13 | PF00071.24 | 1.0 | 9 | 1323.0 | same-strand | Ras family |
| 14 | PF02421.20 | 0.89 | 8 | 1323 | same-strand | Ferrous iron transport protein B |
| 15 | PF08529.13 | 1.0 | 9 | -74.0 | same-strand | NusA N-terminal domain |
| 16 | PF13184.8 | 1.0 | 9 | -74.0 | same-strand | NusA-like KH domain |
| 17 | PF14520.8 | 1.0 | 9 | -74.0 | same-strand | Helix-hairpin-helix domain |
| 18 | PF00575.25 | 1.0 | 9 | -74 | same-strand | S1 RNA binding domain |
| 19 | PF02576.19 | 1.0 | 9 | 143.0 | same-strand | RimP N-terminal domain |
| 20 | PF17384.4 | 1.0 | 9 | 143.0 | same-strand | RimP C-terminal SH3 domain |
| 21 | PF00764.21 | 0.67 | 6 | 1226 | opposite-strand | Arginosuccinate synthase |
| 22 | PF03840.16 | 0.78 | 7 | 4316.0 | same-strand | Preprotein translocase SecG subunit |
++ More..