Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00913 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 3185836 |
Right | 3185910 |
Strand | - |
Nucleotide Sequence | ATGAACAAGAGATCGACGTCCGCGTACAGATCGATCGCAAAAGCGGTGATTTTGACACCTTCCGTCGCTGGTTAG |
Sequence | MNKRSTSAYRSIAKAVILTPSVAG |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 24 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4059963 | 4060037 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 499996 | 500070 | + | NZ_CP061527.1 | Shigella dysenteriae |
3 | 3823528 | 3823602 | - | NZ_LR134340.1 | Escherichia marmotae |
4 | 3317337 | 3317411 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
5 | 3309519 | 3309593 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
6 | 4918791 | 4918865 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
7 | 424690 | 424764 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
8 | 448945 | 449019 | + | NZ_FO704550.1 | Xenorhabdus doucetiae |
9 | 3332628 | 3332702 | - | NZ_FO704551.1 | Xenorhabdus poinarii G6 |
10 | 289471 | 289545 | + | NZ_CP035688.1 | Vibrio metoecus |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00312.24 | 1.0 | 9 | 5653.0 | same-strand | Ribosomal protein S15 |
2 | PF01509.20 | 1.0 | 9 | 4560.0 | same-strand | TruB family pseudouridylate synthase (N terminal domain) |
3 | PF16198.7 | 1.0 | 9 | 4560.0 | same-strand | tRNA pseudouridylate synthase B C-terminal domain |
4 | PF09157.13 | 1.0 | 9 | 4560.0 | same-strand | Pseudouridine synthase II TruB, C-terminal |
5 | PF02033.20 | 1.0 | 9 | 4159.0 | same-strand | Ribosome-binding factor A |
6 | PF11987.10 | 1.0 | 9 | 1323.0 | same-strand | Translation-initiation factor 2 |
7 | PF00009.29 | 1.0 | 9 | 1323.0 | same-strand | Elongation factor Tu GTP binding domain |
8 | PF04760.17 | 1.0 | 9 | 1323.0 | same-strand | Translation initiation factor IF-2, N-terminal region |
9 | PF08364.13 | 1.0 | 9 | 1323.0 | same-strand | Bacterial translation initiation factor IF-2 associated region |
10 | PF03144.27 | 1.0 | 9 | 1323.0 | same-strand | Elongation factor Tu domain 2 |
11 | PF01926.25 | 1.0 | 9 | 1323.0 | same-strand | 50S ribosome-binding GTPase |
12 | PF00025.23 | 0.89 | 8 | 1323 | same-strand | ADP-ribosylation factor family |
13 | PF00071.24 | 1.0 | 9 | 1323.0 | same-strand | Ras family |
14 | PF02421.20 | 0.89 | 8 | 1323 | same-strand | Ferrous iron transport protein B |
15 | PF08529.13 | 1.0 | 9 | -74.0 | same-strand | NusA N-terminal domain |
16 | PF13184.8 | 1.0 | 9 | -74.0 | same-strand | NusA-like KH domain |
17 | PF14520.8 | 1.0 | 9 | -74.0 | same-strand | Helix-hairpin-helix domain |
18 | PF00575.25 | 1.0 | 9 | -74 | same-strand | S1 RNA binding domain |
19 | PF02576.19 | 1.0 | 9 | 143.0 | same-strand | RimP N-terminal domain |
20 | PF17384.4 | 1.0 | 9 | 143.0 | same-strand | RimP C-terminal SH3 domain |
21 | PF00764.21 | 0.67 | 6 | 1226 | opposite-strand | Arginosuccinate synthase |
22 | PF03840.16 | 0.78 | 7 | 4316.0 | same-strand | Preprotein translocase SecG subunit |