Result : EXP00906
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00906 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4283478 |
| Right | 4283543 |
| Strand | - |
| Nucleotide Sequence | ATGATTTTTCGGAAGAGAAGAAAAATTAGCTGGCAGCGCGGGAGATGGAGTTGCCGAGATGTTTGA |
| Sequence | MIFRKRRKISWQRGRWSCRDV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5230810 | 5230875 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3874982 | 3875047 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 3296158 | 3296223 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 4376402 | 4376467 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 4480788 | 4480853 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF15922.7 | 0.75 | 3 | 2158.0 | same-strand | YjeJ-like |
| 2 | PF04055.23 | 1.0 | 4 | 745 | same-strand | Radical SAM superfamily |
| 3 | PF09285.13 | 1.0 | 4 | 137 | opposite-strand | Elongation factor P, C-terminal |
| 4 | PF08207.14 | 1.0 | 4 | 137 | opposite-strand | Elongation factor P (EF-P) KOW-like domain |
| 5 | PF01132.22 | 1.0 | 4 | 137 | opposite-strand | Elongation factor P (EF-P) OB domain |
| 6 | PF08085.13 | 1.0 | 4 | 86.0 | opposite-strand | Entericidin EcnA/B family |
| 7 | PF00893.21 | 1.0 | 4 | 408 | opposite-strand | Small Multidrug Resistance protein |
| 8 | PF08212.14 | 1.0 | 4 | 722 | same-strand | Lipocalin-like domain |
| 9 | PF00061.25 | 1.0 | 4 | 722 | same-strand | Lipocalin / cytosolic fatty-acid binding protein family |
| 10 | PF00144.26 | 1.0 | 4 | 1344 | same-strand | Beta-lactamase |
| 11 | PF02313.19 | 1.0 | 4 | 2540 | same-strand | Fumarate reductase subunit D |
++ More..