Result : EXP00900
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00900 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2397225 |
| Right | 2397284 |
| Strand | - |
| Nucleotide Sequence | GTGATAGAATATCGCCCACTTAATTTTTCCAGGATTTGCCGGTTGTCGGCATCTTTCTAA |
| Sequence | VIEYRPLNFSRICRLSASF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3066384 | 3066443 | - | NZ_LR134340.1 | Escherichia marmotae |
| 2 | 4298273 | 4298332 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 3 | 3249352 | 3249411 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2520688 | 2520747 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 5 | 2522105 | 2522164 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 6 | 1209517 | 1209576 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 2494248 | 2494307 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 4743174 | 4743233 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 4826713 | 4826772 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 10 | 2042686 | 2042745 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 11 | 3890545 | 3890604 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 12 | 4831139 | 4831198 | + | NZ_CP038469.1 | Citrobacter tructae |
| 13 | 2531593 | 2531652 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 14 | 507216 | 507275 | - | NZ_CP053416.1 | Salmonella bongori |
| 15 | 1212195 | 1212254 | - | NZ_CP033744.1 | Citrobacter freundii |
| 16 | 3908422 | 3908481 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07662.15 | 0.8 | 12 | 5090.5 | opposite-strand | Na+ dependent nucleoside transporter C-terminus |
| 2 | PF01773.22 | 0.8 | 12 | 5090.5 | opposite-strand | Na+ dependent nucleoside transporter N-terminus |
| 3 | PF07670.16 | 0.8 | 12 | 5090.5 | opposite-strand | Nucleoside recognition |
| 4 | PF05231.16 | 0.6 | 9 | 2847 | same-strand | MASE1 |
| 5 | PF00563.22 | 0.6 | 9 | 2847 | same-strand | EAL domain |
| 6 | PF07037.13 | 1.0 | 15 | 1871.5 | opposite-strand | Putative transcription regulator (DUF1323) |
| 7 | PF00749.23 | 1.0 | 15 | 16.0 | same-strand | tRNA synthetases class I (E and Q), catalytic domain |
| 8 | PF19269.1 | 1.0 | 15 | 16.0 | same-strand | Anticodon binding domain |
| 9 | PF03466.22 | 0.8 | 12 | 846 | same-strand | LysR substrate binding domain |
| 10 | PF00126.29 | 0.87 | 13 | 878 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 11 | PF03825.18 | 0.67 | 10 | 1844.0 | same-strand | Nucleoside H+ symporter |
| 12 | PF12832.9 | 0.67 | 10 | 1844.0 | same-strand | MFS 1 like family |
| 13 | PF01306.21 | 0.67 | 10 | 1844.0 | same-strand | LacY proton/sugar symporter |
| 14 | PF01048.22 | 0.67 | 10 | 3158.5 | same-strand | Phosphorylase superfamily |
++ More..