Result : B2A4F7
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | 50S ribosomal protein L30 |
| NCBI Accession ID | CP001034.1 |
| Organism | Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF) |
| Left | 228313 |
| Right | 228504 |
| Strand | + |
| Nucleotide Sequence | ATGGCTGATAAAAAATTAAAAGTAACTCTGAAACGCGGTTTAATCGGAGTTTCAGATGGAAAGATAAGGACTATTAAAGCACTAGGACTTAAAAAACGGAGTCACTCCGTTATAAAAAATGATACTCCAGAAATTCGAGGTATGATTGATAAAGTTAGCAACCTTGTTGAAGTCGAGGAATTGGAAGCTTAG |
| Sequence | MADKKLKVTLKRGLIGVSDGKIRTIKALGLKKRSHSVIKNDTPEIRGMIDKVSNLVEVEELEA |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl00203. Profile Description: N/A. This family includes prokaryotic L30 and eukaryotic L7. |
| Pubmed ID | |
| Domain | CDD:412218 |
| Functional Category | Ribosomal_protein |
| Uniprot ID | B2A4F7 |
| ORF Length (Amino Acid) | 63 |
++ More..
| Conservation Analysis |
No. of Species: 277
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 228313 | 228504 | + | NC_010718.1 | Natranaerobius thermophilus JW/NM-WN-LF |
| 2 | 3985377 | 3985565 | - | NZ_CP019659.1 | Paenibacillus larvae subsp. larvae |
| 3 | 295516 | 295701 | + | NZ_CP030032.1 | Bradymonas sediminis |
| 4 | 2065163 | 2065345 | - | NC_007503.1 | Carboxydothermus hydrogenoformans Z-2901 |
| 5 | 6385139 | 6385324 | - | NZ_CP026520.1 | Paenibacillus chitinolyticus |
| 6 | 188146 | 188334 | + | NZ_CP034118.1 | Staphylospora marina |
| 7 | 3070552 | 3070737 | - | NZ_CP048104.1 | Kroppenstedtia pulmonis |
| 8 | 2535201 | 2535383 | - | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
| 9 | 165037 | 165225 | + | NC_014829.1 | Evansella cellulosilytica DSM 2522 |
| 10 | 248275 | 248448 | + | NZ_CP048103.1 | Kroppenstedtia eburnea |
| 11 | 1104896 | 1105081 | + | NZ_AP019004.1 | Phascolarctobacterium faecium |
| 12 | 643235 | 643417 | + | NZ_CP025682.1 | Azoarcus pumilus |
| 13 | 128124 | 128315 | + | NZ_CP012152.1 | Anoxybacillus gonensis |
| 14 | 52682 | 52870 | - | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 15 | 1876755 | 1876946 | + | NZ_CP011232.1 | Kosmotoga pacifica |
| 16 | 2419603 | 2419761 | - | NZ_LR590481.1 | Hathewaya histolytica |
| 17 | 4226396 | 4226572 | + | NZ_CP048286.1 | Paenibacillus rhizovicinus |
| 18 | 705833 | 705994 | + | NC_016148.1 | Thermovirga lienii DSM 17291 |
| 19 | 2258615 | 2258800 | - | NZ_LT906477.1 | Clostridium cochlearium |
| 20 | 275396 | 275572 | + | NZ_LR134338.1 | Brevibacillus brevis |
| 21 | 2954817 | 2954978 | - | NZ_CP045875.1 | Heliorestis convoluta |
| 22 | 4586081 | 4586257 | + | NZ_CP013652.1 | Paenibacillus naphthalenovorans |
| 23 | 1295090 | 1295248 | + | NZ_CP023643.1 | Brochothrix thermosphacta |
| 24 | 8369531 | 8369707 | - | NC_017672.3 | Paenibacillus mucilaginosus K02 |
| 25 | 2944865 | 2945050 | - | NZ_CP054614.1 | Paenibacillus barcinonensis |
| 26 | 2278968 | 2279144 | - | NC_015520.1 | Mahella australiensis 50-1 BON |
| 27 | 3272629 | 3272817 | + | NZ_CP064060.1 | Anoxybacillus caldiproteolyticus |
| 28 | 5013225 | 5013386 | - | NZ_CP009286.1 | Paenibacillus stellifer |
| 29 | 1122276 | 1122452 | - | NZ_CP048429.1 | Paenibacillus jilunlii |
| 30 | 6428947 | 6429123 | - | NZ_CP009287.1 | Paenibacillus graminis |
| 31 | 1144602 | 1144778 | - | NZ_CP068595.1 | Paenibacillus sonchi |
| 32 | 7129869 | 7130045 | - | NZ_LN831776.1 | Paenibacillus riograndensis SBR5 |
| 33 | 7393804 | 7393980 | - | NZ_CP009285.1 | Paenibacillus borealis |
| 34 | 3990865 | 3991050 | + | NZ_CP016809.1 | Paenibacillus ihbetae |
| 35 | 6309284 | 6309460 | - | NZ_CP048209.1 | Paenibacillus lycopersici |
| 36 | 4683609 | 4683794 | - | NZ_CP004078.1 | Paenibacillus sabinae T27 |
| 37 | 138571 | 138753 | + | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 38 | 777276 | 777461 | - | NC_016641.1 | Paenibacillus terrae HPL-003 |
| 39 | 4395107 | 4395292 | + | NZ_CP045295.1 | Paenibacillus cellulositrophicus |
| 40 | 1441967 | 1442143 | - | NC_017095.1 | Fervidobacterium pennivorans DSM 9078 |
| 41 | 1084251 | 1084448 | + | NZ_CP018099.1 | Caldithrix abyssi DSM 13497 |
| 42 | 44229 | 44417 | - | NZ_CP039710.1 | Thermoactinomyces vulgaris |
| 43 | 1642796 | 1642981 | + | NZ_CP034248.1 | Paenibacillus lentus |
| 44 | 236019 | 236207 | - | NC_018178.1 | Melioribacter roseus P3M-2 |
| 45 | 136265 | 136453 | + | NZ_CP019699.1 | Novibacillus thermophilus |
| 46 | 1028524 | 1028709 | + | NC_017464.1 | Ignavibacterium album JCM 16511 |
| 47 | 163978 | 164160 | - | NZ_CP022437.1 | Virgibacillus necropolis |
| 48 | 1755707 | 1755895 | + | NZ_CP043611.1 | Paenibacillus antarcticus |
| 49 | 341987 | 342163 | - | NZ_CP070511.1 | Parageobacillus toebii |
| 50 | 147183 | 147365 | + | NC_018704.1 | Amphibacillus xylanus NBRC 15112 |
| 51 | 149502 | 149678 | + | NZ_AP021853.1 | Sporolactobacillus terrae |
| 52 | 1201857 | 1202027 | + | NZ_CP017703.1 | Aeribacillus pallidus |
| 53 | 244177 | 244341 | + | NC_008593.1 | Clostridium novyi NT |
| 54 | 2454252 | 2454434 | - | NZ_CP014646.1 | Thauera humireducens |
| 55 | 3090617 | 3090793 | - | NZ_CP014342.1 | Geobacillus subterraneus |
| 56 | 2362741 | 2362929 | + | NZ_CP031092.1 | Salicibibacter kimchii |
| 57 | 281413 | 281589 | - | NZ_CP026363.1 | Brevibacillus agri |
| 58 | 640640 | 640819 | + | NZ_CP009761.1 | Parvimonas micra |
| 59 | 5290675 | 5290851 | - | NZ_CP009288.1 | Paenibacillus durus |
| 60 | 28654 | 28839 | - | NZ_CP036523.1 | Peptacetobacter hiranonis |
| 61 | 1635173 | 1635361 | + | NZ_CP063356.1 | Anaerobacillus isosaccharinicus |
| 62 | 2072200 | 2072388 | - | NZ_CP035485.1 | Salicibibacter halophilus |
| 63 | 4493631 | 4493810 | - | NC_014393.1 | Clostridium cellulovorans 743B |
| 64 | 4068289 | 4068468 | - | NZ_CP021850.1 | Pseudoclostridium thermosuccinogenes |
| 65 | 351980 | 352150 | + | NC_021184.1 | Desulfoscipio gibsoniae DSM 7213 |
| 66 | 387160 | 387339 | + | NZ_CP011102.1 | Listeria weihenstephanensis |
| 67 | 221509 | 221685 | - | NZ_CP034437.1 | Paenibacillus albus |
| 68 | 766462 | 766647 | - | NZ_CP068161.1 | Corynebacterium propinquum |
| 69 | 6150639 | 6150815 | - | NZ_CP009428.1 | Paenibacillus odorifer |
| 70 | 974150 | 974350 | + | NC_013501.1 | Rhodothermus marinus DSM 4252 |
| 71 | 2795200 | 2795373 | + | NZ_CP011058.1 | Paenibacillus beijingensis |
| 72 | 2694997 | 2695176 | + | NZ_CP018199.1 | Staphylococcus succinus |
| 73 | 776672 | 776851 | + | NZ_CP064056.1 | Staphylococcus lloydii |
| 74 | 5489451 | 5489636 | - | NC_013440.1 | Haliangium ochraceum DSM 14365 |
| 75 | 730042 | 730221 | + | NZ_LR134089.1 | Staphylococcus saprophyticus |
| 76 | 796735 | 796914 | + | NZ_CP008724.1 | Staphylococcus xylosus |
| 77 | 274990 | 275169 | + | NZ_CP011366.1 | Salinicoccus halodurans |
| 78 | 2653760 | 2653939 | - | NZ_HG917868.1 | Clostridium bornimense |
| 79 | 617658 | 617837 | + | NZ_CP065712.1 | Staphylococcus auricularis |
| 80 | 392334 | 392513 | - | NZ_CP049886.1 | Vagococcus coleopterorum |
| 81 | 1244016 | 1244201 | + | NC_011653.1 | Thermosipho africanus TCF52B |
| 82 | 2251723 | 2251902 | + | NZ_AP018449.1 | Methylomusa anaerophila |
| 83 | 2126015 | 2126200 | - | NC_013740.1 | Acidaminococcus fermentans DSM 20731 |
| 84 | 1259853 | 1260035 | + | NZ_CP064781.1 | Azospira restricta |
| 85 | 1528423 | 1528608 | - | NZ_CP045298.1 | Paenibacillus brasilensis |
| 86 | 668910 | 669095 | + | NZ_CP020028.1 | Paenibacillus kribbensis |
| 87 | 1052258 | 1052437 | - | NZ_CP022096.2 | Staphylococcus pettenkoferi |
| 88 | 1343434 | 1343613 | - | NC_015318.1 | Hippea maritima DSM 10411 |
| 89 | 1548068 | 1548229 | + | NC_015681.1 | Thermodesulfatator indicus DSM 15286 |
| 90 | 1286618 | 1286797 | + | NZ_CP027770.1 | Staphylococcus felis |
| 91 | 486663 | 486848 | + | NZ_CP010827.1 | Corynebacterium singulare |
| 92 | 2690845 | 2691027 | - | NZ_CP068053.1 | Peribacillus psychrosaccharolyticus |
| 93 | 1032518 | 1032703 | - | NZ_CP008796.1 | Thermodesulfobacterium commune DSM 2178 |
| 94 | 2366538 | 2366714 | - | NC_018664.1 | Gottschalkia acidurici 9a |
| 95 | 2286284 | 2286469 | - | NZ_LS483460.1 | Corynebacterium minutissimum |
| 96 | 394523 | 394702 | + | NZ_CP019698.1 | Desulfotomaculum ferrireducens |
| 97 | 482678 | 482857 | + | NZ_CP022046.2 | Mammaliicoccus sciuri |
| 98 | 240417 | 240596 | + | NC_009253.1 | Desulfotomaculum reducens MI-1 |
| 99 | 996951 | 997127 | + | NZ_CP007389.1 | Thermosipho melanesiensis |
| 100 | 584037 | 584222 | + | NZ_CP068345.1 | Succinivibrio dextrinosolvens |
| 101 | 3893568 | 3893750 | - | NZ_CP059164.1 | Nocardioides ungokensis |
| 102 | 1412233 | 1412394 | + | NC_010337.2 | Heliomicrobium modesticaldum Ice1 |
| 103 | 506501 | 506686 | + | NZ_CP009251.1 | Corynebacterium stationis |
| 104 | 867785 | 867970 | - | NC_016751.1 | Marinitoga piezophila KA3 |
| 105 | 4362283 | 4362456 | - | NZ_CP022657.1 | Tumebacillus algifaecis |
| 106 | 1109050 | 1109235 | - | NZ_CP014635.1 | Corynebacterium simulans |
| 107 | 1019685 | 1019855 | + | NC_014364.1 | Sediminispirochaeta smaragdinae DSM 11293 |
| 108 | 312512 | 312691 | + | NC_015589.1 | Desulfotomaculum ruminis DSM 2154 |
| 109 | 2593878 | 2594057 | - | NZ_LR134483.1 | Listeria grayi |
| 110 | 1667232 | 1667411 | - | NZ_LT906470.1 | Veillonella rodentium |
| 111 | 1609488 | 1609667 | - | NZ_AP022321.1 | Veillonella nakazawae |
| 112 | 1666084 | 1666263 | - | NZ_LR134375.1 | Veillonella dispar |
| 113 | 1725751 | 1725930 | - | NZ_LR778174.1 | Veillonella parvula |
| 114 | 508786 | 508971 | + | NZ_LR698967.1 | Corynebacterium ammoniagenes |
| 115 | 129483 | 129665 | + | NC_007530.2 | Bacillus anthracis str. 'Ames Ancestor' |
| 116 | 135128 | 135310 | + | NC_011725.1 | Bacillus cereus B4264 |
| 117 | 2309398 | 2309577 | - | NC_007795.1 | Staphylococcus aureus subsp. aureus NCTC 8325 |
| 118 | 2943498 | 2943674 | + | NZ_CP045798.1 | Thermoanaerosceptrum fracticalcis |
| 119 | 135792 | 135974 | + | NZ_CP024109.1 | Bacillus cytotoxicus |
| 120 | 4039760 | 4039942 | - | NZ_CP016020.1 | Bacillus weihaiensis |
| 121 | 1516208 | 1516393 | - | NZ_LT906446.1 | Megamonas hypermegale |
| 122 | 3311360 | 3311542 | - | NC_016894.1 | Acetobacterium woodii DSM 1030 |
| 123 | 222176 | 222334 | + | NC_011837.1 | Clostridium kluyveri NBRC 12016 |
| 124 | 1410258 | 1410443 | + | NZ_CP059066.1 | Koleobacter methoxysyntrophicus |
| 125 | 4984506 | 4984688 | - | NZ_CP040336.1 | Bacillus luti |
| 126 | 134926 | 135108 | + | NZ_CP064875.1 | Bacillus toyonensis |
| 127 | 864379 | 864558 | + | NZ_CP061336.1 | Ruminiclostridium herbifermentans |
| 128 | 1518373 | 1518555 | - | NZ_CP014161.1 | Aerococcus urinae |
| 129 | 134847 | 135029 | + | NZ_CP032365.1 | Bacillus wiedmannii |
| 130 | 146889 | 147071 | + | NZ_CP012024.1 | Bacillus smithii |
| 131 | 2432176 | 2432358 | - | NZ_CP017704.1 | Peribacillus simplex NBRC 15720 = DSM 1321 |
| 132 | 2373058 | 2373237 | - | NZ_CP023434.1 | Suicoccus acidiformans |
| 133 | 565649 | 565828 | + | NZ_LT906462.1 | Mammaliicoccus stepanovicii |
| 134 | 4219135 | 4219317 | + | NZ_CP061725.1 | Micromonospora craniellae |
| 135 | 2240329 | 2240508 | + | NZ_CP014022.1 | Staphylococcus lugdunensis |
| 136 | 1215389 | 1215574 | - | NC_009718.1 | Fervidobacterium nodosum Rt17-B1 |
| 137 | 141985 | 142164 | + | NC_006270.3 | Bacillus licheniformis DSM 13 = ATCC 14580 |
| 138 | 321476 | 321634 | + | NC_013216.1 | Desulfofarcimen acetoxidans DSM 771 |
| 139 | 1222990 | 1223166 | - | NZ_LR134523.1 | Peptoniphilus ivorii |
| 140 | 140281 | 140469 | + | NC_015581.1 | Thiomicrospira cyclica ALM1 |
| 141 | 466721 | 466906 | + | NC_012590.1 | Corynebacterium aurimucosum ATCC 700975 |
| 142 | 3276647 | 3276832 | - | NC_018518.1 | Bordetella pertussis 18323 |
| 143 | 4129504 | 4129689 | + | NZ_AP019378.1 | Bordetella parapertussis |
| 144 | 5126024 | 5126209 | - | NZ_LR134326.1 | Bordetella bronchiseptica |
| 145 | 1484151 | 1484312 | - | NZ_CP014334.1 | Fervidobacterium islandicum |
| 146 | 1515096 | 1515275 | + | NZ_CP033732.1 | Staphylococcus hominis |
| 147 | 716328 | 716507 | + | NZ_LR134242.1 | Staphylococcus warneri |
| 148 | 754667 | 754846 | - | NC_022737.1 | Staphylococcus pasteuri SP1 |
| 149 | 2163785 | 2163964 | - | NZ_LT906460.1 | Staphylococcus simiae |
| 150 | 2265257 | 2265436 | - | NZ_LR134304.1 | Staphylococcus schweitzeri |
| 151 | 1777259 | 1777438 | - | NZ_CP013911.1 | Staphylococcus haemolyticus |
| 152 | 3928822 | 3929001 | - | NZ_CP013019.1 | Clostridium pasteurianum |
| 153 | 1105192 | 1105347 | + | NZ_CP031699.1 | Neisseria animalis |
| 154 | 3785533 | 3785721 | - | NZ_CP020931.1 | Marinobacter salarius |
| 155 | 2102590 | 2102745 | - | NZ_CP059567.1 | Neisseria shayeganii |
| 156 | 2237826 | 2238011 | - | NZ_CP067012.1 | Corynebacterium kefirresidentii |
| 157 | 750939 | 751097 | - | NZ_CP053988.1 | Abiotrophia defectiva |
| 158 | 1686555 | 1686740 | + | NZ_AP014945.1 | Caldimicrobium thiodismutans |
| 159 | 2272350 | 2272535 | - | NZ_CP009249.1 | Corynebacterium phocae |
| 160 | 251608 | 251793 | + | NC_014926.1 | Thermovibrio ammonificans HB-1 |
| 161 | 380767 | 380952 | + | NZ_CP011311.1 | Corynebacterium camporealensis |
| 162 | 903605 | 903760 | + | NZ_CP018776.1 | Staphylococcus condimenti |
| 163 | 1662620 | 1662799 | - | NZ_CP068061.1 | Mammaliicoccus vitulinus |
| 164 | 1748359 | 1748541 | - | NZ_CP041305.1 | Cytobacillus ciccensis |
| 165 | 136181 | 136369 | + | NC_006510.1 | Geobacillus kaustophilus HTA426 |
| 166 | 136966 | 137154 | - | NZ_CP018058.1 | Geobacillus thermocatenulatus |
| 167 | 448865 | 449050 | + | NZ_CP039247.1 | Corynebacterium endometrii |
| 168 | 656555 | 656740 | + | NZ_CP014176.1 | Clostridium argentinense |
| 169 | 1938123 | 1938305 | - | NZ_CP022983.1 | Cytobacillus kochii |
| 170 | 5281008 | 5281187 | - | NZ_CP020953.1 | Clostridium drakei |
| 171 | 4643014 | 4643193 | + | NZ_CP009933.1 | Clostridium scatologenes |
| 172 | 1484503 | 1484685 | - | NZ_CP017786.1 | Bacillus xiamenensis |
| 173 | 117153 | 117335 | + | NZ_CP011150.1 | Bacillus altitudinis |
| 174 | 1401569 | 1401751 | - | NZ_CP043404.1 | Bacillus safensis |
| 175 | 4430638 | 4430817 | - | NZ_CP011803.1 | Clostridium carboxidivorans P7 |
| 176 | 1283058 | 1283231 | + | NC_013947.1 | Stackebrandtia nassauensis DSM 44728 |
| 177 | 155208 | 155390 | + | NZ_CP023704.1 | Caldibacillus thermoamylovorans |
| 178 | 3786525 | 3786704 | - | NZ_CP011937.1 | Bacillus velezensis |
| 179 | 279862 | 280041 | + | NZ_CP033052.1 | Bacillus vallismortis |
| 180 | 143815 | 143994 | + | NZ_CP048852.1 | Bacillus tequilensis |
| 181 | 144837 | 145016 | + | NZ_CP053376.1 | Bacillus amyloliquefaciens |
| 182 | 143576 | 143755 | + | NZ_CP051464.1 | Bacillus mojavensis |
| 183 | 143701 | 143880 | + | NZ_CP034943.1 | Bacillus subtilis subsp. spizizenii ATCC 6633 = JCM 2499 |
| 184 | 113595 | 113774 | + | NZ_CP013984.1 | Bacillus inaquosorum |
| 185 | 1865648 | 1865827 | - | NZ_CP029364.1 | Bacillus halotolerans |
| 186 | 143875 | 144054 | + | NC_000964.3 | Bacillus subtilis subsp. subtilis str. 168 |
| 187 | 6081776 | 6081946 | + | NC_018025.1 | Desulfomonile tiedjei DSM 6799 |
| 188 | 70590 | 70769 | + | NC_020207.1 | Enterococcus faecium ATCC 8459 = NRRL B-2354 |
| 189 | 489067 | 489252 | + | NZ_CP009246.1 | Corynebacterium flavescens |
| 190 | 2873024 | 2873182 | - | NZ_CP014170.1 | Clostridium tyrobutyricum |
| 191 | 1153706 | 1153891 | + | NZ_LR134313.1 | Neisseria canis |
| 192 | 2348032 | 2348202 | + | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 193 | 77697 | 77876 | + | NZ_CP065211.1 | Enterococcus lactis |
| 194 | 1307381 | 1307560 | + | NZ_LS483464.1 | Corynebacterium renale |
| 195 | 1956883 | 1957044 | - | NC_008025.1 | Deinococcus geothermalis DSM 11300 |
| 196 | 1990619 | 1990798 | + | NZ_CP065729.1 | Macrococcus caseolyticus |
| 197 | 2069985 | 2070170 | - | NZ_CP012395.1 | Clostridium autoethanogenum DSM 10061 |
| 198 | 4437215 | 4437400 | - | NC_014328.1 | Clostridium ljungdahlii DSM 13528 |
| 199 | 74995 | 75174 | + | NZ_CP023074.1 | Enterococcus thailandicus |
| 200 | 581987 | 582166 | - | NZ_CP023011.2 | Enterococcus hirae |
| 201 | 1216789 | 1216971 | - | NC_013522.1 | Thermanaerovibrio acidaminovorans DSM 6589 |
| 202 | 1538173 | 1538358 | - | NZ_CP047165.1 | Pelistega ratti |
| 203 | 2983075 | 2983257 | + | NZ_CP038012.1 | Sporosarcina pasteurii |
| 204 | 712614 | 712793 | + | NZ_CP008747.1 | Staphylococcus hyicus |
| 205 | 175784 | 175972 | + | NZ_CP007030.1 | Thiomicrospira aerophila AL3 |
| 206 | 584971 | 585159 | + | NZ_AP021888.1 | Thiosulfativibrio zosterae |
| 207 | 3165955 | 3166134 | + | NZ_CP018061.1 | Enterococcus mundtii |
| 208 | 108533 | 108718 | - | NZ_HG916765.1 | Castellaniella defragrans 65Phen |
| 209 | 2670076 | 2670264 | - | NZ_CP017715.1 | Marinobacter salinus |
| 210 | 1722090 | 1722269 | - | NZ_LT906464.1 | Staphylococcus muscae |
| 211 | 394581 | 394769 | + | NC_017506.1 | Marinobacter adhaerens HP15 |
| 212 | 2194375 | 2194530 | - | NZ_CP033460.1 | Staphylococcus debuckii |
| 213 | 2733455 | 2733622 | - | NC_017790.1 | Deinococcus gobiensis I-0 |
| 214 | 903175 | 903354 | + | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
| 215 | 3727558 | 3727716 | + | NZ_CP017269.1 | Geosporobacter ferrireducens |
| 216 | 1308004 | 1308186 | - | NZ_CP027228.1 | Mogibacterium diversum |
| 217 | 1203984 | 1204145 | + | NZ_CP059565.1 | Neisseria wadsworthii |
| 218 | 246298 | 246477 | + | NZ_CP047361.1 | Macrococcus canis |
| 219 | 644800 | 644979 | - | NZ_CP020773.1 | Staphylococcus lutrae |
| 220 | 1163474 | 1163632 | + | NZ_AP018712.1 | Tepiditoga spiralis |
| 221 | 159850 | 160029 | + | NZ_CP041666.1 | Radiobacillus deserti |
| 222 | 253657 | 253836 | + | NZ_CP027286.1 | Clostridium chauvoei |
| 223 | 2656447 | 2656611 | - | NC_008346.1 | Syntrophomonas wolfei subsp. wolfei str. Goettingen G311 |
| 224 | 3343287 | 3343466 | - | NZ_CP040924.1 | Clostridium thermarum |
| 225 | 3069732 | 3069920 | - | NC_015152.1 | Sphaerochaeta globosa str. Buddy |
| 226 | 149576 | 149758 | + | NC_022524.1 | Bacillus infantis NRRL B-14911 |
| 227 | 754643 | 754831 | + | NZ_CP021425.1 | Oleiphilus messinensis |
| 228 | 2814396 | 2814566 | - | NC_020134.1 | Thermoclostridium stercorarium subsp. stercorarium DSM 8532 |
| 229 | 339364 | 339546 | + | NC_008578.1 | Acidothermus cellulolyticus 11B |
| 230 | 340756 | 340938 | + | NZ_LN879430.1 | Herbinix luporum |
| 231 | 2018314 | 2018493 | + | NZ_CP023671.1 | Clostridium septicum |
| 232 | 801950 | 802126 | - | NZ_LT635475.1 | Ezakiella massiliensis |
| 233 | 186526 | 186702 | - | NZ_CP046314.1 | Gemella morbillorum |
| 234 | 3262890 | 3263063 | - | NC_015687.1 | Clostridium acetobutylicum DSM 1731 |
| 235 | 5138077 | 5138256 | - | NZ_CP055153.1 | Adhaeribacter radiodurans |
| 236 | 2402478 | 2402645 | - | NZ_CP021081.1 | Deinococcus ficus |
| 237 | 3065389 | 3065550 | + | NC_019793.1 | Deinococcus peraridilitoris DSM 19664 |
| 238 | 1754743 | 1754919 | - | NZ_LR134484.1 | Gemella haemolysans |
| 239 | 309793 | 309960 | + | NZ_CP029494.1 | Deinococcus irradiatisoli |
| 240 | 3679889 | 3680068 | - | NZ_AP023213.1 | Citrifermentans bremense |
| 241 | 2502062 | 2502229 | + | NZ_LN849456.1 | Devriesea agamarum |
| 242 | 274908 | 275066 | + | NZ_CP032416.1 | Clostridium fermenticellae |
| 243 | 1106100 | 1106279 | + | NC_011146.1 | Citrifermentans bemidjiense Bem |
| 244 | 3257779 | 3257937 | - | NZ_CP053073.1 | Usitatibacter palustris |
| 245 | 2055351 | 2055530 | - | NZ_CP021874.1 | Enterococcus wangshanyuanii |
| 246 | 1973321 | 1973500 | - | NC_014925.1 | Staphylococcus pseudintermedius HKU10-03 |
| 247 | 2330339 | 2330527 | + | NZ_CP017705.1 | Brevibacillus laterosporus DSM 25 |
| 248 | 426981 | 427148 | + | NC_015161.1 | Deinococcus proteolyticus MRP |
| 249 | 3350366 | 3350548 | - | NZ_CP064338.1 | Schlegelella thermodepolymerans |
| 250 | 2014001 | 2014156 | + | NZ_LT996885.1 | Dialister massiliensis |
| 251 | 1819136 | 1819291 | - | NZ_CP035130.1 | Gudongella oleilytica |
| 252 | 1621222 | 1621404 | + | NZ_CP048000.1 | Anaerocolumna sedimenticola |
| 253 | 373436 | 373615 | + | NZ_CP051183.1 | Bermanella marisrubri |
| 254 | 3620913 | 3621095 | - | NZ_AP014545.1 | Amphritea japonica ATCC BAA-1530 |
| 255 | 507593 | 507754 | + | NZ_CP019236.1 | Rhodoferax koreense |
| 256 | 292864 | 293046 | + | NC_014532.2 | Halomonas elongata DSM 2581 |
| 257 | 136369 | 136551 | + | NZ_CP014226.1 | Halomonas chromatireducens |
| 258 | 1327911 | 1328084 | + | NC_012881.1 | Maridesulfovibrio salexigens DSM 2638 |
| 259 | 2966411 | 2966584 | - | NC_008261.1 | Clostridium perfringens ATCC 13124 |
| 260 | 1289911 | 1290096 | - | NC_013203.1 | Lancefieldella parvulum DSM 20469 |
| 261 | 5635237 | 5635425 | - | NZ_CP048878.1 | Spartinivicinus ruber |
| 262 | 1164794 | 1164982 | + | NZ_CP016268.1 | Woeseia oceani |
| 263 | 1933561 | 1933716 | - | NZ_CP068564.1 | Keratinibaculum paraultunense |
| 264 | 979876 | 980058 | - | NZ_CP048812.1 | Halomonas socia |
| 265 | 1325033 | 1325236 | + | NC_023151.1 | Thermotoga maritima MSB8 |
| 266 | 259841 | 260020 | + | NZ_CP016786.1 | Clostridium isatidis |
| 267 | 3635549 | 3635731 | - | NZ_CP021435.1 | Halomonas beimenensis |
| 268 | 219199 | 219381 | + | NZ_CP048602.1 | Halomonas piezotolerans |
| 269 | 437590 | 437754 | + | NC_014410.1 | Thermoanaerobacterium thermosaccharolyticum DSM 571 |
| 270 | 213630 | 213812 | + | NZ_AP022843.1 | Halomonas hydrothermalis |
| 271 | 213091 | 213273 | + | NZ_CP065135.1 | Halomonas venusta |
| 272 | 3928124 | 3928306 | - | NZ_CP065435.1 | Halomonas sp. SS10-MC5 |
| 273 | 1334450 | 1334653 | + | NC_013642.1 | Thermotoga naphthophila RKU-10 |
| 274 | 1310846 | 1311049 | + | NC_009486.1 | Thermotoga petrophila RKU-1 |
| 275 | 1269202 | 1269390 | - | NZ_LT821227.1 | Phoenicibacter congonensis |
| 276 | 250649 | 250828 | - | NC_019904.1 | Echinicola vietnamensis DSM 17526 |
| 277 | 248192 | 248371 | - | NZ_CP040106.1 | Echinicola rosea |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_010718.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00253.23 | 0.81 | 225 | 1930 | same-strand | Ribosomal protein S14p/S29e |
| 2 | PF00410.21 | 1.0 | 277 | 1504 | same-strand | Ribosomal protein S8 |
| 3 | PF00347.25 | 1.0 | 277 | 934 | same-strand | Ribosomal protein L6 |
| 4 | PF00861.24 | 0.99 | 275 | 539 | same-strand | Ribosomal L18 of archaea, bacteria, mitoch. and chloroplast |
| 5 | PF00333.22 | 1.0 | 277 | 14 | same-strand | Ribosomal protein S5, N-terminal domain |
| 6 | PF03719.17 | 1.0 | 276 | 14.0 | same-strand | Ribosomal protein S5, C-terminal domain |
| 7 | PF00828.21 | 0.99 | 274 | 21.0 | same-strand | Ribosomal proteins 50S-L15, 50S-L18e, 60S-L27A |
| 8 | PF00344.22 | 1.0 | 276 | 470.0 | same-strand | SecY |
| 9 | PF00406.24 | 0.79 | 220 | 1809.0 | same-strand | Adenylate kinase |
| 10 | PF13207.8 | 0.79 | 220 | 1809.0 | same-strand | AAA domain |
| 11 | PF05191.16 | 0.71 | 197 | 1802 | same-strand | Adenylate kinase, active site lid |
++ More..