Result : EXP00897
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00897 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3238915 |
| Right | 3238977 |
| Strand | - |
| Nucleotide Sequence | TTGGCTTCTGCTCCGGCAGAAAACAATTTTCGAAAAAACCCGCTTCGGCGGGTTTTTTTATAG |
| Sequence | LASAPAENNFRKNPLRRVFL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3377752 | 3377814 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 446358 | 446423 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 532648 | 532716 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 4 | 3880107 | 3880169 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04386.15 | 1.0 | 4 | 974.0 | same-strand | Stringent starvation protein B |
| 2 | PF02798.22 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, N-terminal domain |
| 3 | PF13417.8 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, N-terminal domain |
| 4 | PF13409.8 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, N-terminal domain |
| 5 | PF00043.27 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, C-terminal domain |
| 6 | PF13410.8 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, C-terminal domain |
| 7 | PF00380.21 | 1.0 | 4 | 1.0 | same-strand | Ribosomal protein S9/S16 |
| 8 | PF00572.20 | 1.0 | 4 | 409.0 | same-strand | Ribosomal protein L13 |
| 9 | PF03969.18 | 1.0 | 4 | 1084.0 | same-strand | AFG1-like ATPase |
| 10 | PF06295.14 | 1.0 | 4 | 2403.5 | opposite-strand | Protein of unknown function (DUF1043) |
| 11 | PF00595.26 | 1.0 | 4 | 2956.0 | opposite-strand | PDZ domain |
| 12 | PF13365.8 | 1.0 | 4 | 2956.0 | opposite-strand | Trypsin-like peptidase domain |
| 13 | PF13180.8 | 1.0 | 4 | 2956.0 | opposite-strand | PDZ domain |
| 14 | PF17820.3 | 1.0 | 4 | 2956.0 | opposite-strand | PDZ domain |
| 15 | PF00089.28 | 1.0 | 4 | 2956.0 | opposite-strand | Trypsin |
++ More..