Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00897 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 3238915 |
Right | 3238977 |
Strand | - |
Nucleotide Sequence | TTGGCTTCTGCTCCGGCAGAAAACAATTTTCGAAAAAACCCGCTTCGGCGGGTTTTTTTATAG |
Sequence | LASAPAENNFRKNPLRRVFL |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 20 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3377752 | 3377814 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 446358 | 446423 | + | NZ_CP061527.1 | Shigella dysenteriae |
3 | 532648 | 532716 | + | NZ_CP045845.1 | Kluyvera intermedia |
4 | 3880107 | 3880169 | - | NZ_LR134340.1 | Escherichia marmotae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04386.15 | 1.0 | 4 | 974.0 | same-strand | Stringent starvation protein B |
2 | PF02798.22 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, N-terminal domain |
3 | PF13417.8 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, N-terminal domain |
4 | PF13409.8 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, N-terminal domain |
5 | PF00043.27 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, C-terminal domain |
6 | PF13410.8 | 1.0 | 4 | 330.0 | same-strand | Glutathione S-transferase, C-terminal domain |
7 | PF00380.21 | 1.0 | 4 | 1.0 | same-strand | Ribosomal protein S9/S16 |
8 | PF00572.20 | 1.0 | 4 | 409.0 | same-strand | Ribosomal protein L13 |
9 | PF03969.18 | 1.0 | 4 | 1084.0 | same-strand | AFG1-like ATPase |
10 | PF06295.14 | 1.0 | 4 | 2403.5 | opposite-strand | Protein of unknown function (DUF1043) |
11 | PF00595.26 | 1.0 | 4 | 2956.0 | opposite-strand | PDZ domain |
12 | PF13365.8 | 1.0 | 4 | 2956.0 | opposite-strand | Trypsin-like peptidase domain |
13 | PF13180.8 | 1.0 | 4 | 2956.0 | opposite-strand | PDZ domain |
14 | PF17820.3 | 1.0 | 4 | 2956.0 | opposite-strand | PDZ domain |
15 | PF00089.28 | 1.0 | 4 | 2956.0 | opposite-strand | Trypsin |