Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00895 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 867328 |
Right | 867411 |
Strand | - |
Nucleotide Sequence | TTGAGGGAAATAAGACGATGCCGCTTTACCCAGTTTAACCTGCACTTTATTCTCAACGACTTGCCTGTATTGGCTCCCTTTTAA |
Sequence | LREIRRCRFTQFNLHFILNDLPVLAPF |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 27 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1008697 | 1008780 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 883409 | 883492 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 828832 | 828915 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 2825840 | 2825923 | + | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00768.22 | 0.67 | 2 | 1480 | opposite-strand | D-alanyl-D-alanine carboxypeptidase |
2 | PF07943.15 | 0.67 | 2 | 1480 | opposite-strand | Penicillin-binding protein 5, C-terminal domain |
3 | PF00455.24 | 1.0 | 3 | 675.0 | same-strand | DeoR C terminal sensor domain |
4 | PF08220.14 | 1.0 | 3 | 675.0 | same-strand | DeoR-like helix-turn-helix domain |
5 | PF01569.23 | 1.0 | 3 | 21.0 | same-strand | PAP2 superfamily |
6 | PF14378.8 | 1.0 | 3 | 21.0 | same-strand | PAP2 superfamily |
7 | PF07690.18 | 0.67 | 2 | 181 | opposite-strand | Major Facilitator Superfamily |
8 | PF08282.14 | 0.67 | 2 | 1824 | same-strand | haloacid dehalogenase-like hydrolase |
9 | PF00702.28 | 0.67 | 2 | 1824 | same-strand | haloacid dehalogenase-like hydrolase |
10 | PF17940.3 | 0.67 | 2 | 3931 | opposite-strand | Tetracyclin repressor-like, C-terminal domain |
11 | PF00440.25 | 0.67 | 2 | 3931 | opposite-strand | Bacterial regulatory proteins, tetR family |
12 | PF01527.22 | 0.67 | 2 | 2175.0 | opposite-strand | Transposase |
13 | PF00665.28 | 0.67 | 2 | 2005.5 | opposite-strand | Integrase core domain |
14 | PF13683.8 | 0.67 | 2 | 2005.5 | opposite-strand | Integrase core domain |