Result : EXP00892
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00892 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1874912 |
| Right | 1875001 |
| Strand | - |
| Nucleotide Sequence | TTGAGCAGGCAATCGAACAACCGCTGGATCCACAACGCCTGGCTACCGGGGTCCGCAATGAAGAAGAGGCGCTGGAAATCTATTTCCTGA |
| Sequence | LSRQSNNRWIHNAWLPGSAMKKRRWKSIS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1929188 | 1929277 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1893061 | 1893150 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2531156 | 2531245 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2500840 | 2500929 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2564680 | 2564769 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 6 | 1920827 | 1920925 | + | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 3791035 | 3791124 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 8 | 2004826 | 2004915 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 3706747 | 3706824 | - | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
| 10 | 1974206 | 1974283 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06440.13 | 0.78 | 7 | 3850.0 | opposite-strand | DNA polymerase III, theta subunit |
| 2 | PF00929.26 | 0.89 | 8 | 2406 | opposite-strand | Exonuclease |
| 3 | PF02897.17 | 0.89 | 8 | 349 | same-strand | Prolyl oligopeptidase, N-terminal beta-propeller domain |
| 4 | PF00326.23 | 0.89 | 8 | 349 | same-strand | Prolyl oligopeptidase family |
| 5 | PF04391.14 | 1.0 | 9 | -89.0 | same-strand | Protein of unknown function (DUF533) |
| 6 | PF13995.8 | 0.89 | 8 | 728 | same-strand | YebF-like protein |
| 7 | PF07130.14 | 0.78 | 7 | 1054.0 | same-strand | YebG protein |
| 8 | PF02222.24 | 0.78 | 7 | 1499.5 | opposite-strand | ATP-grasp domain |
| 9 | PF02655.16 | 0.78 | 7 | 1499.5 | opposite-strand | ATP-grasp domain |
++ More..