Result : EXP00884
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00884 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 971689 |
| Right | 971841 |
| Strand | - |
| Nucleotide Sequence | ATGAAGGTATCGCTGGCTGCGTTGAGGATTAACGCTACGCCCGCCACGATCAGACCCGCTTTGAAAGGCGCAATGGTTGGCCACAGTCGGCGGAATGTCTGCCACGTAGAGAGATCTTTGTCGTTATGCATTCAAAAAACCAGCATTTGTTGA |
| Sequence | MKVSLAALRINATPATIRPALKGAMVGHSRRNVCHVERSLSLCIQKTSIC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 50 |
++ More..
| Conservation Analysis |
No. of Species: 52
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1096242 | 1096394 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 989301 | 989453 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 966599 | 966751 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 950384 | 950536 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 1466862 | 1467014 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 1080645 | 1080797 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 1640498 | 1640650 | - | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 3865726 | 3865878 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 9 | 3225918 | 3226070 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 10 | 40611 | 40742 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 11 | 1070416 | 1070568 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 12 | 3507020 | 3507172 | - | NZ_CP053416.1 | Salmonella bongori |
| 13 | 1742508 | 1742660 | + | NZ_CP038469.1 | Citrobacter tructae |
| 14 | 4474818 | 4474970 | - | NZ_CP033744.1 | Citrobacter freundii |
| 15 | 641339 | 641491 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 16 | 1996922 | 1997053 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 17 | 1603968 | 1604099 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 18 | 1869196 | 1869327 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 19 | 4131160 | 4131291 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 20 | 3194268 | 3194420 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 21 | 1552464 | 1552595 | - | NC_015968.1 | Enterobacter soli |
| 22 | 1677094 | 1677225 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 23 | 1389429 | 1389560 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 24 | 1704366 | 1704518 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 25 | 494770 | 494901 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 26 | 1801114 | 1801245 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 27 | 3988026 | 3988178 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 28 | 3486364 | 3486516 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 29 | 1300352 | 1300504 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 30 | 773064 | 773195 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 31 | 1613536 | 1613667 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 32 | 2925779 | 2925925 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 33 | 2752780 | 2752911 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 34 | 3014841 | 3014993 | + | NZ_CP035129.1 | Kosakonia cowanii |
| 35 | 2492505 | 2492636 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 36 | 2880437 | 2880583 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 37 | 1586690 | 1586821 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 38 | 1542539 | 1542670 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 39 | 1851972 | 1852103 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 40 | 2601498 | 2601629 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 41 | 3140916 | 3141059 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 42 | 1690907 | 1691059 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 43 | 2255227 | 2255361 | + | NZ_CP060401.1 | Xenorhabdus nematophila |
| 44 | 2162618 | 2162749 | + | NZ_CP034035.1 | Brenneria rubrifaciens |
| 45 | 1480708 | 1480842 | - | NZ_LS483470.1 | Leminorella richardii |
| 46 | 2469886 | 2470029 | + | NZ_LR134531.1 | Pragia fontium |
| 47 | 1451313 | 1451477 | - | NZ_CP015581.1 | Tatumella citrea |
| 48 | 3126684 | 3126812 | + | NZ_CP048796.1 | Providencia vermicola |
| 49 | 892771 | 892905 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 50 | 2204214 | 2204348 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 51 | 940551 | 940700 | - | NZ_CP018804.1 | Histophilus somni |
| 52 | 1193168 | 1193320 | + | NZ_CP034752.1 | Jinshanibacter zhutongyuii |
| 53 | 2230799 | 2230933 | + | NZ_CP071325.1 | Photobacterium ganghwense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_013716.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02224.20 | 0.88 | 46 | 4733 | opposite-strand | Cytidylate kinase |
| 2 | PF13189.8 | 0.77 | 40 | 4733 | opposite-strand | Cytidylate kinase-like family |
| 3 | PF00575.25 | 0.9 | 47 | 2932.0 | opposite-strand | S1 RNA binding domain |
| 4 | PF00216.23 | 0.9 | 47 | 2491.0 | opposite-strand | Bacterial DNA-binding protein |
| 5 | PF03772.18 | 1.0 | 52 | 15 | opposite-strand | Competence protein |
| 6 | PF00753.29 | 0.98 | 51 | 15.0 | opposite-strand | Metallo-beta-lactamase superfamily |
| 7 | PF13567.8 | 0.62 | 32 | 15 | opposite-strand | Domain of unknown function (DUF4131) |
| 8 | PF00664.25 | 1.0 | 52 | -124 | opposite-strand | ABC transporter transmembrane region |
| 9 | PF00005.29 | 1.0 | 52 | -124.0 | opposite-strand | ABC transporter |
| 10 | PF02463.21 | 0.96 | 50 | -124.0 | opposite-strand | RecF/RecN/SMC N terminal domain |
| 11 | PF00270.31 | 0.87 | 45 | -128.5 | opposite-strand | DEAD/DEAH box helicase |
| 12 | PF13191.8 | 0.94 | 49 | -125.5 | opposite-strand | AAA ATPase domain |
| 13 | PF02606.16 | 0.98 | 51 | 1619.5 | opposite-strand | Tetraacyldisaccharide-1-P 4'-kinase |
| 14 | PF06224.14 | 0.79 | 41 | 2640.0 | opposite-strand | Winged helix DNA-binding domain |
| 15 | PF03966.18 | 0.98 | 51 | 3921.5 | opposite-strand | Trm112p-like protein |
| 16 | PF02348.21 | 0.98 | 51 | 4100.5 | opposite-strand | Cytidylyltransferase |
| 17 | PF00275.22 | 0.63 | 33 | 5601 | opposite-strand | EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase) |
++ More..