Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00877 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 2294598 |
Right | 2294642 |
Strand | - |
Nucleotide Sequence | ATGCTTTACATGCAATGTTATATAGTGAATTGTTCTGATTCTTAA |
Sequence | MLYMQCYIVNCSDS |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 14 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3133651 | 3133695 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 2407346 | 2407390 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 1318745 | 1318789 | + | NZ_CP061527.1 | Shigella dysenteriae |
4 | 2415459 | 2415503 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00346.21 | 1.0 | 3 | 3489.0 | same-strand | Respiratory-chain NADH dehydrogenase, 49 Kd subunit |
2 | PF00329.21 | 1.0 | 3 | 3489.0 | same-strand | Respiratory-chain NADH dehydrogenase, 30 Kd subunit |
3 | PF01058.24 | 1.0 | 3 | 2733.0 | same-strand | NADH ubiquinone oxidoreductase, 20 Kd subunit |
4 | PF00507.21 | 1.0 | 3 | 2274.0 | same-strand | NADH-ubiquinone/plastoquinone oxidoreductase, chain 3 |
5 | PF03466.22 | 1.0 | 3 | 705.0 | same-strand | LysR substrate binding domain |
6 | PF00126.29 | 1.0 | 3 | 705.0 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
7 | PF00155.23 | 1.0 | 3 | 170.5 | opposite-strand | Aminotransferase class I and II |
8 | PF12917.9 | 1.0 | 3 | 1471.5 | opposite-strand | HD containing hydrolase-like enzyme |
9 | PF13023.8 | 1.0 | 3 | 1471.5 | opposite-strand | HD domain |
10 | PF01966.24 | 1.0 | 3 | 1471.5 | opposite-strand | HD domain |
11 | PF02080.23 | 1.0 | 3 | 2129.5 | same-strand | TrkA-C domain |
12 | PF13419.8 | 1.0 | 3 | 4048.5 | same-strand | Haloacid dehalogenase-like hydrolase |
13 | PF00702.28 | 1.0 | 3 | 4048.5 | same-strand | haloacid dehalogenase-like hydrolase |
14 | PF03887.16 | 1.0 | 3 | 4709.5 | same-strand | YfbU domain |