Result : EXP00867
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00867 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2609891 |
| Right | 2609953 |
| Strand | - |
| Nucleotide Sequence | GTGTCAGTGCTGAGCATATCTGCTGCACTTCAGATTCTGACTGTACATCATAGAGCACCATAG |
| Sequence | VSVLSISAALQILTVHHRAP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3463629 | 3463691 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2742027 | 2742089 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 1034330 | 1034392 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 2743377 | 2743439 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00793.22 | 0.67 | 2 | 2227 | same-strand | DAHP synthetase I family |
| 2 | PF10973.10 | 0.67 | 2 | 1652 | opposite-strand | Protein of unknown function (DUF2799) |
| 3 | PF13689.8 | 0.67 | 2 | 984 | opposite-strand | YfiR/HmsC-like |
| 4 | PF00990.23 | 1.0 | 3 | -62.0 | opposite-strand | Diguanylate cyclase, GGDEF domain |
| 5 | PF00691.22 | 1.0 | 3 | 186.0 | opposite-strand | OmpA family |
| 6 | PF01245.22 | 1.0 | 3 | 744.5 | same-strand | Ribosomal protein L19 |
| 7 | PF01746.23 | 1.0 | 3 | 1133.5 | same-strand | tRNA (Guanine-1)-methyltransferase |
| 8 | PF01782.20 | 1.0 | 3 | 1931.5 | same-strand | RimM N-terminal domain |
| 9 | PF05239.18 | 1.0 | 3 | 1931.5 | same-strand | PRC-barrel domain |
| 10 | PF00886.21 | 0.67 | 2 | 2499 | same-strand | Ribosomal protein S16 |
++ More..