Result : EXP00864
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00864 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2052796 |
| Right | 2052855 |
| Strand | - |
| Nucleotide Sequence | ATGAAACACTATCGGGAATCGTCTGAATGGCGGGCACATTTGCGAGCACGCATCCAGTAA |
| Sequence | MKHYRESSEWRAHLRARIQ |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2829444 | 2829503 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2142048 | 2142110 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 2706542 | 2706601 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06029.13 | 0.67 | 2 | 5597.0 | same-strand | AlkA N-terminal domain |
| 2 | PF13672.8 | 0.67 | 2 | 1481.0 | same-strand | Protein phosphatase 2C |
| 3 | PF00092.30 | 0.67 | 2 | 744.0 | same-strand | von Willebrand factor type A domain |
| 4 | PF13519.8 | 0.67 | 2 | 744.0 | same-strand | von Willebrand factor type A domain |
| 5 | PF13533.8 | 1.0 | 3 | 82 | opposite-strand | Biotin-lipoyl like |
| 6 | PF13437.8 | 1.0 | 3 | 82 | opposite-strand | HlyD family secretion protein |
| 7 | PF16576.7 | 1.0 | 3 | 82 | opposite-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
| 8 | PF00873.21 | 1.0 | 3 | 2890.0 | opposite-strand | AcrB/AcrD/AcrF family |
| 9 | PF07690.18 | 1.0 | 3 | 7530 | opposite-strand | Major Facilitator Superfamily |
| 10 | PF02518.28 | 1.0 | 3 | 8942 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 11 | PF00672.27 | 1.0 | 3 | 8942 | opposite-strand | HAMP domain |
| 12 | PF00512.27 | 1.0 | 3 | 8942 | opposite-strand | His Kinase A (phospho-acceptor) domain |
++ More..