Result : EXP00863
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00863 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1471162 |
| Right | 1471257 |
| Strand | - |
| Nucleotide Sequence | ATGAATGTTTCCAGTAGAACTGTAGTACTGATAAATGTCTTTGCTGCTGTTGGTTTGTTTACTCTTATCTCTATGAGATTTGGCTGGTTTATTTGA |
| Sequence | MNVSSRTVVLINVFAAVGLFTLISMRFGWFI |
| Source of smORF | Ribo-seq |
| Function | integral component of membrane [GO:0016021]; plasma membrane [GO:0005886];INDUCTION: Expressed during stationary phase (Pubmed:19121005), in minimal glucose or glycerol medium and at 45 degrees Celsius (Pubmed:19734316) (at protein level) Pubmed:19121005,19734316 The ORF matches to the profile of NF000537. Profile Description: stress response membrane protein YncL. |
| Pubmed ID | 30904393 |
| Domain | CDD:333721 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | A5A615 |
| ORF Length (Amino Acid) | 31 |
++ More..
| Conservation Analysis |
No. of Species: 46
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2032999 | 2033094 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1809435 | 1809530 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2026846 | 2026941 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1504722 | 1504817 | - | NZ_AP014857.1 | Escherichia albertii |
| 5 | 2249469 | 2249564 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 1517099 | 1517194 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 7 | 3096791 | 3096886 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 8 | 1694285 | 1694380 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 3847253 | 3847348 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 10 | 189161 | 189256 | + | NZ_CP033744.1 | Citrobacter freundii |
| 11 | 4819828 | 4819923 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 12 | 1429970 | 1430065 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 13 | 1005423 | 1005518 | + | NZ_CP038469.1 | Citrobacter tructae |
| 14 | 546437 | 546532 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 15 | 1686628 | 1686723 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 16 | 4087056 | 4087151 | + | NZ_CP053416.1 | Salmonella bongori |
| 17 | 2242664 | 2242756 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 18 | 3145898 | 3145993 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 19 | 2426381 | 2426473 | - | NZ_CP054254.1 | Klebsiella variicola |
| 20 | 2896832 | 2896924 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 21 | 2342920 | 2343012 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 22 | 3094637 | 3094732 | + | NZ_CP050508.1 | Raoultella terrigena |
| 23 | 2402298 | 2402390 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 24 | 3204624 | 3204716 | + | NZ_CP060111.1 | Klebsiella michiganensis |
| 25 | 2138697 | 2138789 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 26 | 636747 | 636839 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 27 | 1857546 | 1857638 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 28 | 1127266 | 1127358 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 29 | 2340465 | 2340557 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 30 | 2968790 | 2968882 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 31 | 4309419 | 4309514 | - | NZ_CP026047.1 | Raoultella planticola |
| 32 | 2727649 | 2727744 | + | NZ_CP041247.1 | Raoultella electrica |
| 33 | 1922336 | 1922428 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 34 | 784156 | 784248 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 35 | 1883768 | 1883860 | - | NC_015968.1 | Enterobacter soli |
| 36 | 1820324 | 1820416 | - | NC_015968.1 | Enterobacter soli |
| 37 | 1889073 | 1889165 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 38 | 1917392 | 1917484 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 39 | 4385377 | 4385469 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 40 | 2475546 | 2475638 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 41 | 2563283 | 2563375 | + | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 42 | 2523157 | 2523249 | + | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 43 | 1496618 | 1496710 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 44 | 941603 | 941695 | - | NZ_CP027107.1 | Cronobacter sakazakii |
| 45 | 1709490 | 1709582 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 46 | 2793744 | 2793836 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 47 | 2887305 | 2887397 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 48 | 1582906 | 1582998 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 49 | 3419243 | 3419335 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00171.24 | 0.61 | 28 | 1220 | opposite-strand | Aldehyde dehydrogenase family |
++ More..