Result : EXP00859
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00859 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3510888 |
| Right | 3510920 |
| Strand | - |
| Nucleotide Sequence | ATGACATATTGCGCTCCTGATTGTTGCAGGTAG |
| Sequence | MTYCAPDCCR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 10 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3624190 | 3624222 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 4382943 | 4382975 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 3648502 | 3648534 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 316015 | 316047 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP061527.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04445.15 | 1.0 | 3 | 5372.0 | same-strand | Putative SAM-dependent methyltransferase |
| 2 | PF01432.22 | 1.0 | 3 | 3323.0 | same-strand | Peptidase family M3 |
| 3 | PF19310.1 | 1.0 | 3 | 3323.0 | same-strand | Neurolysin/Thimet oligopeptidase, N-terminal domain |
| 4 | PF04378.15 | 1.0 | 3 | 2278.0 | opposite-strand | Ribosomal RNA large subunit methyltransferase D, RlmJ |
| 5 | PF07992.16 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 6 | PF02852.24 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 7 | PF00070.29 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 8 | PF13738.8 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 9 | PF03400.15 | 0.67 | 2 | 2263 | same-strand | IS1 transposase |
| 10 | PF02040.17 | 1.0 | 3 | 401.5 | opposite-strand | Arsenical pump membrane protein |
| 11 | PF03600.18 | 1.0 | 3 | 401.5 | opposite-strand | Citrate transporter |
| 12 | PF03960.17 | 1.0 | 3 | 1703.5 | opposite-strand | ArsC family |
| 13 | PF01022.22 | 0.67 | 2 | -6 | opposite-strand | Bacterial regulatory protein, arsR family |
| 14 | PF12840.9 | 0.67 | 2 | -6 | opposite-strand | Helix-turn-helix domain |
++ More..