Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00859 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 3510888 |
Right | 3510920 |
Strand | - |
Nucleotide Sequence | ATGACATATTGCGCTCCTGATTGTTGCAGGTAG |
Sequence | MTYCAPDCCR |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 10 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3624190 | 3624222 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
2 | 4382943 | 4382975 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
3 | 3648502 | 3648534 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
4 | 316015 | 316047 | - | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04445.15 | 1.0 | 3 | 5372.0 | same-strand | Putative SAM-dependent methyltransferase |
2 | PF01432.22 | 1.0 | 3 | 3323.0 | same-strand | Peptidase family M3 |
3 | PF19310.1 | 1.0 | 3 | 3323.0 | same-strand | Neurolysin/Thimet oligopeptidase, N-terminal domain |
4 | PF04378.15 | 1.0 | 3 | 2278.0 | opposite-strand | Ribosomal RNA large subunit methyltransferase D, RlmJ |
5 | PF07992.16 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
6 | PF02852.24 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
7 | PF00070.29 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
8 | PF13738.8 | 1.0 | 3 | 854.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
9 | PF03400.15 | 0.67 | 2 | 2263 | same-strand | IS1 transposase |
10 | PF02040.17 | 1.0 | 3 | 401.5 | opposite-strand | Arsenical pump membrane protein |
11 | PF03600.18 | 1.0 | 3 | 401.5 | opposite-strand | Citrate transporter |
12 | PF03960.17 | 1.0 | 3 | 1703.5 | opposite-strand | ArsC family |
13 | PF01022.22 | 0.67 | 2 | -6 | opposite-strand | Bacterial regulatory protein, arsR family |
14 | PF12840.9 | 0.67 | 2 | -6 | opposite-strand | Helix-turn-helix domain |