Result : EXP00854
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00854 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1911344 |
| Right | 1911430 |
| Strand | - |
| Nucleotide Sequence | GTGATGAGTTCAAACAAAGCGAAGGCGACCCCCATGTTAAAGGACGGATCCGTCAGATGCAGCGAGCTGCCGCACGGCGTCGGATGA |
| Sequence | VMSSNKAKATPMLKDGSVRCSELPHGVG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 28 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1960211 | 1960297 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 2567493 | 2567579 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1965426 | 1965512 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 1905582 | 1905668 | - | NZ_AP014857.1 | Escherichia albertii |
| 5 | 2531928 | 2532014 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 1741063 | 1741149 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06366.15 | 1.0 | 5 | 2452.5 | same-strand | Flagellar protein FlhE |
| 2 | PF01312.21 | 1.0 | 5 | -86.0 | same-strand | FlhB HrpN YscU SpaS Family |
| 3 | PF00750.21 | 0.6 | 3 | 3266.5 | opposite-strand | tRNA synthetases class I (R) |
| 4 | PF05746.17 | 0.6 | 3 | 3266.5 | opposite-strand | DALR anticodon binding domain |
| 5 | PF03485.18 | 0.6 | 3 | 3266.5 | opposite-strand | Arginyl tRNA synthetase N terminal domain |
| 6 | PF00771.22 | 0.8 | 4 | 376 | same-strand | FHIPEP family |
++ More..