Result : EXP00849
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00849 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1036815 |
| Right | 1036916 |
| Strand | - |
| Nucleotide Sequence | ATGATCAATCTGCTGTTATTTCACGCTATCAATGCACTTTTGGCTGTTTTTCAGGCAAACAAACAAATTAGGGGTTTACACGCCGCATCGGGATGTTTATAG |
| Sequence | MINLLLFHAINALLAVFQANKQIRGLHAASGCL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 33 |
++ More..
| Conservation Analysis |
No. of Species: 28
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1210989 | 1211090 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1031726 | 1031827 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2718338 | 2718439 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1019649 | 1019750 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 1043370 | 1043462 | - | NZ_AP014857.1 | Escherichia albertii |
| 6 | 1937368 | 1937469 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 7 | 1142920 | 1143021 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 3323683 | 3323784 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 1745628 | 1745729 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 10 | 3806618 | 3806719 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 11 | 3563672 | 3563773 | + | NZ_CP053416.1 | Salmonella bongori |
| 12 | 1175195 | 1175296 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 13 | 1698551 | 1698643 | - | NZ_LR134340.1 | Escherichia marmotae |
| 14 | 4534386 | 4534487 | + | NZ_CP033744.1 | Citrobacter freundii |
| 15 | 579670 | 579771 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 16 | 3651687 | 3651788 | + | NZ_CP026047.1 | Raoultella planticola |
| 17 | 2432901 | 2433002 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 18 | 1683210 | 1683299 | - | NZ_CP038469.1 | Citrobacter tructae |
| 19 | 3924969 | 3925070 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 20 | 1601418 | 1601519 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 21 | 1646220 | 1646321 | + | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 22 | 1330884 | 1330976 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 23 | 1602159 | 1602260 | + | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 24 | 2542049 | 2542150 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 25 | 2674270 | 2674371 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 26 | 1792440 | 1792541 | - | NZ_CP027107.1 | Cronobacter sakazakii |
| 27 | 1735668 | 1735760 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 28 | 1503330 | 1503413 | + | NZ_CP015581.1 | Tatumella citrea |
| 29 | 3214111 | 3214203 | - | NZ_CP023525.1 | Cedecea neteri |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF17785.3 | 0.75 | 21 | 3378 | opposite-strand | PUA-like domain |
| 2 | PF00708.20 | 1.0 | 28 | 3001.5 | same-strand | Acylphosphatase |
| 3 | PF04358.15 | 1.0 | 28 | 2675.5 | opposite-strand | DsrC like protein |
| 4 | PF01027.22 | 1.0 | 28 | 1924.0 | opposite-strand | Inhibitor of apoptosis-promoting Bax1 |
++ More..