Result : EXP00848
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00848 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 231951 |
| Right | 232016 |
| Strand | - |
| Nucleotide Sequence | ATGCAGAGGATTTTTGCGATTCTGGCAATAATAGATATACAGACGAAAAAAAACCTCGAGCGTTAA |
| Sequence | MQRIFAILAIIDIQTKKNLER |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 229024 | 229089 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 851791 | 851856 | - | NZ_LR134340.1 | Escherichia marmotae |
| 3 | 1372061 | 1372120 | + | NZ_CP044098.1 | Citrobacter portucalensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03180.16 | 1.0 | 3 | 8099 | same-strand | NlpA lipoprotein |
| 2 | PF00528.24 | 1.0 | 3 | 7406 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 3 | PF00005.29 | 1.0 | 3 | 6382 | same-strand | ABC transporter |
| 4 | PF09383.12 | 1.0 | 3 | 6382 | same-strand | NIL domain |
| 5 | PF02463.21 | 1.0 | 3 | 6382 | same-strand | RecF/RecN/SMC N terminal domain |
| 6 | PF13401.8 | 1.0 | 3 | 6382 | same-strand | AAA domain |
| 7 | PF13242.8 | 1.0 | 3 | 5622 | opposite-strand | HAD-hyrolase-like |
| 8 | PF00248.23 | 1.0 | 3 | 78 | opposite-strand | Aldo/keto reductase family |
| 9 | PF03466.22 | 1.0 | 3 | 878 | same-strand | LysR substrate binding domain |
| 10 | PF00126.29 | 1.0 | 3 | 878 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 11 | PF03372.25 | 1.0 | 3 | 2055 | opposite-strand | Endonuclease/Exonuclease/phosphatase family |
| 12 | PF08241.14 | 1.0 | 3 | 2912 | opposite-strand | Methyltransferase domain |
| 13 | PF13649.8 | 1.0 | 3 | 2912 | opposite-strand | Methyltransferase domain |
| 14 | PF08242.14 | 1.0 | 3 | 2912 | opposite-strand | Methyltransferase domain |
| 15 | PF01476.22 | 0.67 | 2 | 3619.0 | same-strand | LysM domain |
| 16 | PF01464.22 | 0.67 | 2 | 3619.0 | same-strand | Transglycosylase SLT domain |
| 17 | PF13489.8 | 0.67 | 2 | 3510.0 | opposite-strand | Methyltransferase domain |
++ More..