Result : EXP00847
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00847 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3334669 |
| Right | 3334716 |
| Strand | - |
| Nucleotide Sequence | TTGAACAGTGCTGGGTTTGTGCGGCTTCACTGCGCGAACGCGGGTTAG |
| Sequence | LNSAGFVRLHCANAG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4195102 | 4195149 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2381252 | 2381299 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 3 | 3475068 | 3475115 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 365076 | 365123 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3444345 | 3444392 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 6 | 3963151 | 3963198 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00009.29 | 1.0 | 5 | 1554 | same-strand | Elongation factor Tu GTP binding domain |
| 2 | PF03764.20 | 1.0 | 5 | 1554.0 | same-strand | Elongation factor G, domain IV |
| 3 | PF14492.8 | 1.0 | 5 | 1554.0 | same-strand | Elongation Factor G, domain III |
| 4 | PF00679.26 | 1.0 | 5 | 1554.0 | same-strand | Elongation factor G C-terminus |
| 5 | PF03144.27 | 1.0 | 5 | 1554 | same-strand | Elongation factor Tu domain 2 |
| 6 | PF00177.23 | 1.0 | 5 | 987.0 | same-strand | Ribosomal protein S7p/S5e |
| 7 | PF00164.27 | 1.0 | 5 | 516.0 | same-strand | Ribosomal protein S12/S23 |
| 8 | PF04077.14 | 1.0 | 5 | 103.0 | same-strand | DsrH like protein |
| 9 | PF02635.17 | 1.0 | 5 | 85.0 | same-strand | DsrE/DsrF-like family |
| 10 | PF08348.13 | 1.0 | 5 | 603.0 | same-strand | YheO-like PAS domain |
| 11 | PF13309.8 | 1.0 | 5 | 603.0 | same-strand | HTH domain |
| 12 | PF13384.8 | 1.0 | 5 | 603.0 | same-strand | Homeodomain-like domain |
| 13 | PF00254.30 | 1.0 | 5 | 1492 | same-strand | FKBP-type peptidyl-prolyl cis-trans isomerase |
| 14 | PF01346.20 | 1.0 | 5 | 1492.0 | same-strand | Domain amino terminal to FKBP-type peptidyl-prolyl isomerase |
| 15 | PF04102.14 | 1.0 | 5 | 2524.5 | opposite-strand | SlyX |
++ More..