Result : EXP00841

Protein Information

• Protein name: EXP00841
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 2603452
• Right: 2603496
• Strand: -
• Nucleotide Sequence: TTGATGAGATCGATAGCGACTAAATCGCTTCAGTTTCACAACTGA
• Sequence: LMRSIATKSLQFHN
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 14

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2736937	2736981	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	3457189	3457233	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
3	2735588	2735632	-	NC_004337.2	Shigella flexneri 2a str. 301
4	1041990	1042034	-	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_004337.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF07724.16	0.67	2	2764	same-strand	AAA domain (Cdc48 subfamily)
2	PF17871.3	0.67	2	2764	same-strand	AAA lid domain
3	PF02861.22	0.67	2	2764	same-strand	Clp amino terminal domain, pathogenicity island component
4	PF10431.11	0.67	2	2764	same-strand	C-terminal, D2-small domain, of ClpB protein
5	PF00004.31	0.67	2	2764	same-strand	ATPase family associated with various cellular activities (AAA)
6	PF07728.16	0.67	2	2764	same-strand	AAA domain (dynein-related subfamily)
7	PF02578.17	0.67	2	1903	same-strand	Multi-copper polyphenol oxidoreductase laccase
8	PF00849.24	0.67	2	926	same-strand	RNA pseudouridylate synthase
9	PF01479.27	0.67	2	926	same-strand	S4 domain
10	PF13525.8	0.67	2	54	opposite-strand	Outer membrane lipoprotein
11	PF13512.8	0.67	2	54	opposite-strand	Tetratricopeptide repeat
12	PF02482.21	1.0	3	173.0	opposite-strand	Sigma 54 modulation protein / S30EA ribosomal protein
13	PF00800.20	1.0	3	764.0	opposite-strand	Prephenate dehydratase
14	PF01817.23	1.0	3	1366.0	both-strands	Chorismate mutase type II
15	PF02153.19	1.0	3	1967.0	same-strand	Prephenate dehydrogenase
16	PF00793.22	1.0	3	3099.0	same-strand	DAHP synthetase I family
17	PF10973.10	0.67	2	4382	opposite-strand	Protein of unknown function (DUF2799)
18	PF13006.9	0.67	2	371.0	both-strands	Insertion element 4 transposase N-terminal