Result : EXP00840
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00840 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3742132 |
| Right | 3742215 |
| Strand | - |
| Nucleotide Sequence | ATCACATTGATGAATGTTAGCCAGATATACGCCAGGAATGGGGAATTGTTTAGCGGCAGAATATGTAAACAAAAGCGGCAATAA |
| Sequence | ITLMNVSQIYARNGELFSGRICKQKRQ |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is considerably higher during exponential phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSH6 |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3853766 | 3853840 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4644366 | 4644443 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 4100321 | 4100395 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13710.8 | 1.0 | 2 | 2674 | same-strand | ACT domain |
| 2 | PF01842.27 | 1.0 | 2 | 2674 | same-strand | ACT domain |
| 3 | PF13291.8 | 1.0 | 2 | 2674 | same-strand | ACT domain |
| 4 | PF02776.20 | 1.0 | 2 | 982 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 5 | PF02775.23 | 1.0 | 2 | 982 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 6 | PF00205.24 | 1.0 | 2 | 982 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 7 | PF13939.8 | 1.0 | 2 | 124 | opposite-strand | Toxin TisB, type I toxin-antitoxin system |
| 8 | PF07690.18 | 1.0 | 2 | 82 | opposite-strand | Major Facilitator Superfamily |
| 9 | PF02656.17 | 1.0 | 2 | 1942.5 | same-strand | Domain of unknown function (DUF202) |
++ More..