Result : EXP00839
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00839 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1036709 |
| Right | 1036783 |
| Strand | - |
| Nucleotide Sequence | TTGAAGGCACCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA |
| Sequence | LKAPVLKTGDPKGFQSSNLCASAK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 31
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1698445 | 1698519 | - | NZ_LR134340.1 | Escherichia marmotae |
| 2 | 1210883 | 1210957 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1031620 | 1031694 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 1019543 | 1019617 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 2718471 | 2718545 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 98389 | 98463 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 1043264 | 1043338 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 1951647 | 1951721 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 9 | 4190556 | 4190630 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 10 | 3570565 | 3570639 | - | NZ_CP054254.1 | Klebsiella variicola |
| 11 | 3322849 | 3322923 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 12 | 2520898 | 2520972 | - | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
| 13 | 1760609 | 1760695 | + | NC_014306.1 | Erwinia billingiae Eb661 |
| 14 | 2114459 | 2114533 | + | NZ_AP018786.1 | Sutterella megalosphaeroides |
| 15 | 3198080 | 3198154 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 16 | 2938903 | 2938977 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
| 17 | 940085 | 940150 | - | NZ_CP019239.1 | Rhodoferax saidenbachensis |
| 18 | 4593836 | 4593898 | + | NZ_CP014136.1 | Gibbsiella quercinecans |
| 19 | 3111690 | 3111755 | + | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 20 | 2955947 | 2956033 | - | NZ_CP043869.1 | Neptunomonas concharum |
| 21 | 1747089 | 1747154 | - | NZ_CP036281.1 | Polystyrenella longa |
| 22 | 1358216 | 1358281 | + | NZ_CP032487.1 | Yersinia hibernica |
| 23 | 1880107 | 1880172 | + | NZ_CP043727.1 | Yersinia canariae |
| 24 | 1317275 | 1317343 | - | NC_013515.1 | Streptobacillus moniliformis DSM 12112 |
| 25 | 31891 | 31959 | + | NZ_CP011078.1 | Yersinia ruckeri |
| 26 | 2912477 | 2912563 | + | NZ_AP014862.1 | Pseudomonas furukawaii |
| 27 | 3903064 | 3903129 | + | NZ_CP017476.1 | Hydrogenophaga crassostreae |
| 28 | 1609858 | 1609929 | - | NZ_CP047650.1 | Xylophilus rhododendri |
| 29 | 3986434 | 3986508 | - | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 30 | 3355812 | 3355874 | + | NZ_CP023706.1 | Edwardsiella tarda |
| 31 | 1565964 | 1566026 | + | NZ_LS483470.1 | Leminorella richardii |
| 32 | 754966 | 755034 | + | NC_015676.1 | Methanosalsum zhilinae DSM 4017 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00708.20 | 0.61 | 19 | 1372 | same-strand | Acylphosphatase |
| 2 | PF04358.15 | 0.65 | 20 | 1057.5 | opposite-strand | DsrC like protein |
++ More..