Result : EXP00832
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00832 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1876345 |
| Right | 1876389 |
| Strand | - |
| Nucleotide Sequence | ATGATAAAATGCTTGATACGGCGGATCTGCTTGACACCTGGCTGA |
| Sequence | MIKCLIRRICLTPG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2532589 | 2532633 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1930621 | 1930665 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2502270 | 2502314 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1919468 | 1919512 | + | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 1894494 | 1894538 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04391.14 | 1.0 | 4 | 914 | same-strand | Protein of unknown function (DUF533) |
| 2 | PF13995.8 | 1.0 | 4 | 231 | same-strand | YebF-like protein |
| 3 | PF07130.14 | 0.75 | 3 | -44.0 | same-strand | YebG protein |
| 4 | PF02222.24 | 1.0 | 4 | 216 | opposite-strand | ATP-grasp domain |
| 5 | PF02655.16 | 1.0 | 4 | 216 | opposite-strand | ATP-grasp domain |
| 6 | PF01081.21 | 1.0 | 4 | 1450 | same-strand | KDPG and KHG aldolase |
| 7 | PF00920.23 | 1.0 | 4 | 2128 | same-strand | Dehydratase family |
| 8 | PF02781.18 | 1.0 | 4 | 4174 | same-strand | Glucose-6-phosphate dehydrogenase, C-terminal domain |
| 9 | PF00479.24 | 1.0 | 4 | 4174 | same-strand | Glucose-6-phosphate dehydrogenase, NAD binding domain |
| 10 | PF02897.17 | 0.75 | 3 | 1779 | same-strand | Prolyl oligopeptidase, N-terminal beta-propeller domain |
| 11 | PF00326.23 | 0.75 | 3 | 1779 | same-strand | Prolyl oligopeptidase family |
++ More..