Result : EXP00830
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00830 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 57695 |
| Right | 57745 |
| Strand | - |
| Nucleotide Sequence | ATGTCGATAAAACCGACGCTGCGCAGAAAGATCGTGCATACCGCATGCTGA |
| Sequence | MSIKPTLRRKIVHTAC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 58475 | 58525 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 53499 | 53549 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 52817 | 52867 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3542000 | 3542050 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3596129 | 3596179 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 57440 | 57490 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04379.16 | 1.0 | 5 | 1893.0 | same-strand | ApaG domain |
| 2 | PF00398.22 | 1.0 | 5 | 1069.0 | same-strand | Ribosomal RNA adenine dimethylase |
| 3 | PF04166.14 | 1.0 | 5 | 83.0 | same-strand | Pyridoxal phosphate biosynthetic protein PdxA |
| 4 | PF00639.23 | 1.0 | 5 | -50.0 | same-strand | PPIC-type PPIASE domain |
| 5 | PF13616.8 | 1.0 | 5 | -50.0 | same-strand | PPIC-type PPIASE domain |
| 6 | PF09312.13 | 1.0 | 5 | -50.0 | same-strand | SurA N-terminal domain |
| 7 | PF04453.16 | 1.0 | 5 | 1206.0 | same-strand | LPS transport system D |
| 8 | PF03968.16 | 1.0 | 5 | 1206.0 | same-strand | LptA/(LptD N-terminal domain) LPS transport protein |
| 9 | PF00226.33 | 1.0 | 5 | 3815.0 | opposite-strand | DnaJ domain |
| 10 | PF05099.15 | 1.0 | 5 | 3815.0 | opposite-strand | Tellurite resistance protein TerB |
| 11 | PF00849.24 | 1.0 | 5 | 5413.0 | same-strand | RNA pseudouridylate synthase |
| 12 | PF12137.10 | 0.8 | 4 | 5420.5 | same-strand | RNA polymerase recycling family C-terminal |
| 13 | PF18337.3 | 0.8 | 4 | 5420.5 | same-strand | RapA N-terminal Tudor like domain |
| 14 | PF18339.3 | 0.8 | 4 | 5420.5 | same-strand | RapA N-terminal Tudor like domain 1 |
| 15 | PF00271.33 | 0.8 | 4 | 5420.5 | same-strand | Helicase conserved C-terminal domain |
| 16 | PF04851.17 | 0.8 | 4 | 5420.5 | same-strand | Type III restriction enzyme, res subunit |
| 17 | PF00270.31 | 0.8 | 4 | 5420.5 | same-strand | DEAD/DEAH box helicase |
| 18 | PF00136.23 | 0.6 | 3 | 8490 | same-strand | DNA polymerase family B |
++ More..