Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00830 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 57695 |
Right | 57745 |
Strand | - |
Nucleotide Sequence | ATGTCGATAAAACCGACGCTGCGCAGAAAGATCGTGCATACCGCATGCTGA |
Sequence | MSIKPTLRRKIVHTAC |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 16 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 58475 | 58525 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 53499 | 53549 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 52817 | 52867 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 3542000 | 3542050 | + | NZ_CP061527.1 | Shigella dysenteriae |
5 | 3596129 | 3596179 | - | NZ_CP057657.1 | Escherichia fergusonii |
6 | 57440 | 57490 | - | NZ_AP014857.1 | Escherichia albertii |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04379.16 | 1.0 | 5 | 1893.0 | same-strand | ApaG domain |
2 | PF00398.22 | 1.0 | 5 | 1069.0 | same-strand | Ribosomal RNA adenine dimethylase |
3 | PF04166.14 | 1.0 | 5 | 83.0 | same-strand | Pyridoxal phosphate biosynthetic protein PdxA |
4 | PF00639.23 | 1.0 | 5 | -50.0 | same-strand | PPIC-type PPIASE domain |
5 | PF13616.8 | 1.0 | 5 | -50.0 | same-strand | PPIC-type PPIASE domain |
6 | PF09312.13 | 1.0 | 5 | -50.0 | same-strand | SurA N-terminal domain |
7 | PF04453.16 | 1.0 | 5 | 1206.0 | same-strand | LPS transport system D |
8 | PF03968.16 | 1.0 | 5 | 1206.0 | same-strand | LptA/(LptD N-terminal domain) LPS transport protein |
9 | PF00226.33 | 1.0 | 5 | 3815.0 | opposite-strand | DnaJ domain |
10 | PF05099.15 | 1.0 | 5 | 3815.0 | opposite-strand | Tellurite resistance protein TerB |
11 | PF00849.24 | 1.0 | 5 | 5413.0 | same-strand | RNA pseudouridylate synthase |
12 | PF12137.10 | 0.8 | 4 | 5420.5 | same-strand | RNA polymerase recycling family C-terminal |
13 | PF18337.3 | 0.8 | 4 | 5420.5 | same-strand | RapA N-terminal Tudor like domain |
14 | PF18339.3 | 0.8 | 4 | 5420.5 | same-strand | RapA N-terminal Tudor like domain 1 |
15 | PF00271.33 | 0.8 | 4 | 5420.5 | same-strand | Helicase conserved C-terminal domain |
16 | PF04851.17 | 0.8 | 4 | 5420.5 | same-strand | Type III restriction enzyme, res subunit |
17 | PF00270.31 | 0.8 | 4 | 5420.5 | same-strand | DEAD/DEAH box helicase |
18 | PF00136.23 | 0.6 | 3 | 8490 | same-strand | DNA polymerase family B |