Result : EXP00829
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00829 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1810782 |
| Right | 1810859 |
| Strand | - |
| Nucleotide Sequence | ATGATTAATTGTGACCAAACTCAAACTTCTGGCACTTGGAGTGCTTATCGCAACGTCTGCAGGCGTAGCGCACGCTGA |
| Sequence | MINCDQTQTSGTWSAYRNVCRRSAR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2468147 | 2468224 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1866405 | 1866482 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1476358 | 1476435 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2243631 | 2243708 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1976613 | 1976690 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 1367882 | 1367956 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 1801471 | 1801554 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 3496750 | 3496824 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 9 | 1714903 | 1714977 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 10 | 3515908 | 3515982 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01641.20 | 0.89 | 8 | 3976 | same-strand | SelR domain |
| 2 | PF02800.22 | 0.89 | 8 | 2639 | opposite-strand | Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain |
| 3 | PF00044.26 | 0.89 | 8 | 2639 | opposite-strand | Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain |
| 4 | PF01263.22 | 1.0 | 9 | 1672.5 | opposite-strand | Aldose 1-epimerase |
| 5 | PF00248.23 | 0.67 | 6 | 769 | same-strand | Aldo/keto reductase family |
| 6 | PF06629.14 | 1.0 | 9 | -67.0 | same-strand | MltA-interacting protein MipA |
| 7 | PF08298.13 | 0.78 | 7 | 426.0 | opposite-strand | PrkA AAA domain |
| 8 | PF06798.14 | 0.78 | 7 | 426.0 | opposite-strand | PrkA serine protein kinase C-terminal domain |
| 9 | PF04285.14 | 0.78 | 7 | 2488.5 | opposite-strand | Protein of unknown function (DUF444) |
| 10 | PF00990.23 | 0.78 | 7 | 4040.5 | opposite-strand | Diguanylate cyclase, GGDEF domain |
| 11 | PF17155.6 | 0.89 | 8 | 4842 | opposite-strand | Gammaproteobacterial periplasmic sensor domain |
| 12 | PF04073.17 | 0.89 | 8 | 6375 | opposite-strand | Aminoacyl-tRNA editing domain |
++ More..