Result : EXP00828
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00828 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1116499 |
| Right | 1116567 |
| Strand | - |
| Nucleotide Sequence | GTGAATGTTTACCTATGCTTAGCGGTGAAGCCGCGCAAAGTGTTTTTGATGGCGACTATGATGAGATAG |
| Sequence | VNVYLCLAVKPRKVFLMATMMR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1516243 | 1516311 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 2 | 1473214 | 1473282 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1113932 | 1114000 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 1123958 | 1124026 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01757.24 | 1.0 | 3 | 4990.5 | same-strand | Acyltransferase family |
| 2 | PF04349.14 | 1.0 | 3 | 3062.0 | opposite-strand | Periplasmic glucan biosynthesis protein, MdoG |
| 3 | PF00535.28 | 1.0 | 3 | 526.0 | opposite-strand | Glycosyl transferase family 2 |
| 4 | PF13632.8 | 1.0 | 3 | 526.0 | opposite-strand | Glycosyl transferase family group 2 |
| 5 | PF13506.8 | 1.0 | 3 | 526.0 | opposite-strand | Glycosyl transferase family 21 |
| 6 | PF13984.8 | 1.0 | 3 | -68.0 | same-strand | MsyB protein |
| 7 | PF03279.15 | 0.67 | 2 | 1662 | same-strand | Bacterial lipid A biosynthesis acyltransferase |
| 8 | PF17773.3 | 0.67 | 2 | 2807 | opposite-strand | UPF0176 acylphosphatase like domain |
| 9 | PF12368.10 | 0.67 | 2 | 2807 | opposite-strand | Rhodanase C-terminal |
| 10 | PF00581.22 | 0.67 | 2 | 2807 | opposite-strand | Rhodanese-like domain |
| 11 | PF12832.9 | 0.67 | 2 | 264.0 | same-strand | MFS 1 like family |
++ More..