Result : EXP00824
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00824 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3201288 |
| Right | 3201338 |
| Strand | - |
| Nucleotide Sequence | ATGAAAGCCCCGCAACACGTTGCGGGGCTTTTTACATTCGATAACCGGTAA |
| Sequence | MKAPQHVAGLFTFDNR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4075269 | 4075319 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3332789 | 3332839 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3324971 | 3325021 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 484022 | 484072 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3316353 | 3316403 | - | NZ_AP014857.1 | Escherichia albertii |
| 6 | 2257455 | 2257505 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 3837943 | 3837993 | - | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 3941070 | 3941120 | + | NZ_CP038469.1 | Citrobacter tructae |
| 9 | 4887618 | 4887668 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 10 | 332133 | 332183 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 11 | 501925 | 501975 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01985.23 | 0.9 | 9 | 4560.5 | opposite-strand | CRS1 / YhbY (CRM) domain |
| 2 | PF03449.17 | 1.0 | 10 | 3929 | same-strand | Transcription elongation factor, N-terminal |
| 3 | PF01272.21 | 1.0 | 10 | 3929 | same-strand | Transcription elongation factor, GreA/GreB, C-term |
| 4 | PF02113.17 | 1.0 | 10 | 2248 | opposite-strand | D-Ala-D-Ala carboxypeptidase 3 (S13) family |
| 5 | PF01018.24 | 1.0 | 10 | 1035 | same-strand | GTP1/OBG |
| 6 | PF01926.25 | 1.0 | 10 | 1035 | same-strand | 50S ribosome-binding GTPase |
| 7 | PF00892.22 | 1.0 | 10 | 54 | same-strand | EamA-like transporter family |
| 8 | PF01016.21 | 1.0 | 10 | 23 | same-strand | Ribosomal L27 protein |
| 9 | PF00829.23 | 0.8 | 8 | 301 | same-strand | Ribosomal prokaryotic L21 protein |
| 10 | PF00348.19 | 1.0 | 10 | 871 | opposite-strand | Polyprenyl synthetase |
| 11 | PF13693.8 | 1.0 | 10 | 2069 | opposite-strand | Winged helix-turn-helix DNA-binding |
| 12 | PF00275.22 | 1.0 | 10 | 2396 | same-strand | EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase) |
++ More..