Result : EXP00823
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00823 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4524282 |
| Right | 4524356 |
| Strand | - |
| Nucleotide Sequence | ATGGTAGCAAAATGTAATGCCGCAACTGTTTGTGATACAGCATCATCGGCGTCAATACTAATCCCATCAGAATGA |
| Sequence | MVAKCNAATVCDTASSASILIPSE |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4605907 | 4605981 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 5464394 | 5464468 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 4572766 | 4572840 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3649720 | 3649794 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3498044 | 3498118 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 592754 | 592828 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00196.21 | 1.0 | 5 | 1396.5 | opposite-strand | Bacterial regulatory proteins, luxR family |
| 2 | PF06276.14 | 1.0 | 5 | 244.0 | same-strand | Ferric iron reductase FhuF-like transporter |
| 3 | PF11575.10 | 1.0 | 5 | 244.0 | same-strand | FhuF 2Fe-2S C-terminal domain |
| 4 | PF07256.14 | 1.0 | 5 | -74.0 | opposite-strand | Protein of unknown function (DUF1435) |
| 5 | PF05175.16 | 1.0 | 5 | 654.5 | same-strand | Methyltransferase small domain |
| 6 | PF08468.13 | 1.0 | 5 | 654.5 | same-strand | Methyltransferase small domain N-terminal |
| 7 | PF13649.8 | 1.0 | 5 | 654.5 | same-strand | Methyltransferase domain |
| 8 | PF08242.14 | 1.0 | 5 | 654.5 | same-strand | Methyltransferase domain |
| 9 | PF08241.14 | 1.0 | 5 | 654.5 | same-strand | Methyltransferase domain |
| 10 | PF03603.15 | 1.0 | 5 | 1788.5 | opposite-strand | DNA polymerase III psi subunit |
| 11 | PF00583.27 | 1.0 | 5 | 2170.5 | opposite-strand | Acetyltransferase (GNAT) family |
| 12 | PF13508.9 | 1.0 | 5 | 2170.5 | opposite-strand | Acetyltransferase (GNAT) domain |
| 13 | PF00702.28 | 1.0 | 5 | 2631.5 | opposite-strand | haloacid dehalogenase-like hydrolase |
| 14 | PF13242.8 | 1.0 | 5 | 2631.5 | opposite-strand | HAD-hyrolase-like |
| 15 | PF12710.9 | 1.0 | 5 | 2631.5 | opposite-strand | haloacid dehalogenase-like hydrolase |
| 16 | PF16658.7 | 0.8 | 4 | 3418 | opposite-strand | Class II release factor RF3, C-terminal domain |
| 17 | PF00009.29 | 0.8 | 4 | 3418 | opposite-strand | Elongation factor Tu GTP binding domain |
| 18 | PF03144.27 | 0.8 | 4 | 3418 | opposite-strand | Elongation factor Tu domain 2 |
| 19 | PF01926.25 | 0.8 | 4 | 3418 | opposite-strand | 50S ribosome-binding GTPase |
| 20 | PF14492.8 | 0.8 | 4 | 3418 | opposite-strand | Elongation Factor G, domain III |
++ More..