Result : EXP00820
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00820 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4159702 |
| Right | 4159752 |
| Strand | - |
| Nucleotide Sequence | ATGTTGAACCTTACGCTTTACCGATGCCCGTGCTGGCGAGGGCAACCGTAG |
| Sequence | MLNLTLYRCPCWRGQP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4252330 | 4252380 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 5105639 | 5105686 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 4337404 | 4337451 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3741027 | 3741074 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02264.17 | 0.67 | 2 | 2928 | opposite-strand | LamB porin |
| 2 | PF07148.14 | 0.67 | 2 | 1856 | opposite-strand | Maltose operon periplasmic protein precursor (MalM) |
| 3 | PF13981.8 | 0.67 | 2 | 47 | opposite-strand | SopA-like central domain |
| 4 | PF13599.8 | 0.67 | 2 | 47 | opposite-strand | Pentapeptide repeats (9 copies) |
| 5 | PF00805.24 | 0.67 | 2 | 462.5 | opposite-strand | Pentapeptide repeats (8 copies) |
| 6 | PF04345.15 | 1.0 | 3 | 129.0 | opposite-strand | Chorismate lyase |
| 7 | PF01040.20 | 1.0 | 3 | 639.0 | opposite-strand | UbiA prenyltransferase family |
| 8 | PF01553.23 | 1.0 | 3 | 1666.0 | same-strand | Acyltransferase |
| 9 | PF01219.21 | 1.0 | 3 | 4260.0 | opposite-strand | Prokaryotic diacylglycerol kinase |
| 10 | PF00717.25 | 1.0 | 3 | 4738.0 | opposite-strand | Peptidase S24-like |
| 11 | PF01726.18 | 1.0 | 3 | 4738.0 | opposite-strand | LexA DNA binding domain |
| 12 | PF00005.29 | 0.67 | 2 | 4339.5 | opposite-strand | ABC transporter |
| 13 | PF17912.3 | 0.67 | 2 | 4339.5 | opposite-strand | MalK OB fold domain |
| 14 | PF08402.12 | 0.67 | 2 | 4339.5 | opposite-strand | TOBE domain |
++ More..