Result : EXP00819
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00819 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3057872 |
| Right | 3057928 |
| Strand | - |
| Nucleotide Sequence | ATGAAGAACATAGAACCTGGTTTTGCGCACGTTATGCCTGGTATTGTCAACAGATGA |
| Sequence | MKNIEPGFAHVMPGIVNR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3191771 | 3191827 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 617542 | 617598 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 3931428 | 3931484 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 3181146 | 3181202 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 3182754 | 3182810 | - | NZ_AP014857.1 | Escherichia albertii |
| 6 | 3711634 | 3711690 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08971.13 | 1.0 | 5 | -56.0 | same-strand | Glycogen synthesis protein |
| 2 | PF07290.13 | 0.6 | 3 | 381.0 | opposite-strand | Protein of unknown function (DUF1449) |
| 3 | PF15975.7 | 0.8 | 4 | 1037 | opposite-strand | Flotillin |
| 4 | PF01145.27 | 0.6 | 3 | 1037.0 | opposite-strand | SPFH domain / Band 7 family |
| 5 | PF00294.26 | 0.8 | 4 | 3490 | same-strand | pfkB family carbohydrate kinase |
| 6 | PF01467.28 | 0.8 | 4 | 3490 | same-strand | Cytidylyltransferase-like |
| 7 | PF03710.17 | 0.8 | 4 | 4971 | same-strand | Glutamate-ammonia ligase adenylyltransferase |
| 8 | PF08335.13 | 0.8 | 4 | 4971 | same-strand | GlnD PII-uridylyltransferase |
| 9 | PF01928.23 | 0.8 | 4 | 7834 | same-strand | CYTH domain |
| 10 | PF04380.15 | 0.8 | 4 | 66.5 | opposite-strand | Membrane fusogenic activity |
| 11 | PF00926.21 | 0.8 | 4 | 740.0 | same-strand | 3,4-dihydroxy-2-butanone 4-phosphate synthase |
++ More..