Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00818 |
NCBI Accession ID | CP001509.3 |
Organism | Escherichia coli BL21(DE3) |
Left | 620747 |
Right | 620809 |
Strand | - |
Nucleotide Sequence | ATGTTATCCGTAATGCATTTTGAAAAAGTATTGTTACAGCCAGATCACAGCGCAGAACGATAA |
Sequence | MLSVMHFEKVLLQPDHSAER |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 20 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 741742 | 741804 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 660385 | 660447 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 690074 | 690136 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 3081395 | 3081457 | + | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00313.24 | 1.0 | 3 | 2885 | opposite-strand | 'Cold-shock' DNA-binding domain |
2 | PF02537.17 | 1.0 | 3 | 2448.0 | same-strand | CrcB-like protein, Camphor Resistance (CrcB) |
3 | PF00795.24 | 1.0 | 3 | 1567 | opposite-strand | Carbon-nitrogen hydrolase |
4 | PF02416.18 | 1.0 | 3 | 1235.0 | opposite-strand | mttA/Hcf106 family |
5 | PF04055.23 | 1.0 | 3 | 169.0 | same-strand | Radical SAM superfamily |
6 | PF03466.22 | 0.67 | 2 | -22 | same-strand | LysR substrate binding domain |
7 | PF00126.29 | 1.0 | 3 | -22.0 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
8 | PF03099.21 | 1.0 | 3 | 1190.5 | same-strand | Biotin/lipoate A/B protein ligase family |
9 | PF04359.16 | 1.0 | 3 | 1932.5 | same-strand | Protein of unknown function (DUF493) |
10 | PF00768.22 | 1.0 | 3 | 2306.0 | same-strand | D-alanyl-D-alanine carboxypeptidase |
11 | PF07943.15 | 1.0 | 3 | 2306.0 | same-strand | Penicillin-binding protein 5, C-terminal domain |
12 | PF03330.20 | 1.0 | 3 | 3656.5 | same-strand | Lytic transglycolase |
13 | PF05036.15 | 1.0 | 3 | 3656.5 | same-strand | SPOR domain |