Result : EXP00818
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00818 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 620747 |
| Right | 620809 |
| Strand | - |
| Nucleotide Sequence | ATGTTATCCGTAATGCATTTTGAAAAAGTATTGTTACAGCCAGATCACAGCGCAGAACGATAA |
| Sequence | MLSVMHFEKVLLQPDHSAER |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 741742 | 741804 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 660385 | 660447 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 690074 | 690136 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3081395 | 3081457 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00313.24 | 1.0 | 3 | 2885 | opposite-strand | 'Cold-shock' DNA-binding domain |
| 2 | PF02537.17 | 1.0 | 3 | 2448.0 | same-strand | CrcB-like protein, Camphor Resistance (CrcB) |
| 3 | PF00795.24 | 1.0 | 3 | 1567 | opposite-strand | Carbon-nitrogen hydrolase |
| 4 | PF02416.18 | 1.0 | 3 | 1235.0 | opposite-strand | mttA/Hcf106 family |
| 5 | PF04055.23 | 1.0 | 3 | 169.0 | same-strand | Radical SAM superfamily |
| 6 | PF03466.22 | 0.67 | 2 | -22 | same-strand | LysR substrate binding domain |
| 7 | PF00126.29 | 1.0 | 3 | -22.0 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 8 | PF03099.21 | 1.0 | 3 | 1190.5 | same-strand | Biotin/lipoate A/B protein ligase family |
| 9 | PF04359.16 | 1.0 | 3 | 1932.5 | same-strand | Protein of unknown function (DUF493) |
| 10 | PF00768.22 | 1.0 | 3 | 2306.0 | same-strand | D-alanyl-D-alanine carboxypeptidase |
| 11 | PF07943.15 | 1.0 | 3 | 2306.0 | same-strand | Penicillin-binding protein 5, C-terminal domain |
| 12 | PF03330.20 | 1.0 | 3 | 3656.5 | same-strand | Lytic transglycolase |
| 13 | PF05036.15 | 1.0 | 3 | 3656.5 | same-strand | SPOR domain |
++ More..