| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00812 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 3821733 |
| Right | 3821810 |
| Strand | - |
| Nucleotide Sequence | ATCATCCGGCAACTTAATCCTTCCAGACCGCAGCGGTGGAAAACTTCTTCTACGTTTGGCGTTTCTCGCCAACCATAA |
| Sequence | IIRQLNPSRPQRWKTSSTFGVSRQP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3448343 | 3448417 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 2 | 2487347 | 2487421 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 3 | 4814189 | 4814263 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 4 | 5352469 | 5352534 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 5 | 5377781 | 5377846 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 6 | 3136281 | 3136346 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 7 | 6962 | 7036 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 8 | 5069850 | 5069924 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 9 | 438737 | 438811 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 10 | 3608730 | 3608804 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 11 | 75010 | 75084 | - | NZ_CP045720.1 | Pantoea eucalypti |
| 12 | 86387 | 86461 | - | NC_017554.1 | Pantoea ananatis PA13 |
| 13 | 4692763 | 4692837 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 14 | 4568147 | 4568221 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 15 | 8334 | 8408 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 16 | 3198102 | 3198176 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 17 | 68549 | 68614 | - | NZ_CP034148.1 | Pantoea agglomerans |
| 18 | 77542 | 77607 | - | NZ_CP038853.1 | Pantoea vagans |
| 19 | 8282 | 8356 | - | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 20 | 1360217 | 1360288 | + | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 21 | 4521419 | 4521493 | + | NZ_CP026377.1 | Mixta gaviniae |
| 22 | 4215832 | 4215906 | + | NZ_CP061511.1 | Mixta calida |
| 23 | 1641603 | 1641677 | - | NZ_CP019706.1 | Pantoea alhagi |
| 24 | 2907826 | 2907900 | - | NZ_CP049115.1 | Pantoea stewartii |
| 25 | 1464424 | 1464498 | + | NZ_CP065640.1 | Serratia rubidaea |
| 26 | 3158990 | 3159064 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 27 | 3989225 | 3989299 | + | NZ_CP023567.1 | Erwinia pyrifoliae |
| 28 | 2513760 | 2513837 | - | NZ_CP023567.1 | Erwinia pyrifoliae |
| 29 | 3773372 | 3773449 | + | NZ_CP016043.1 | Edwardsiella hoshinae |
| 30 | 5216914 | 5216988 | + | NZ_CP038662.1 | Serratia nematodiphila |
| 31 | 4423984 | 4424058 | + | NZ_CP016948.1 | Serratia surfactantfaciens |
| 32 | 5079310 | 5079384 | - | NZ_CP071320.1 | Serratia ureilytica |
| 33 | 1703863 | 1703940 | + | NZ_CP023706.1 | Edwardsiella tarda |
| 34 | 971822 | 971896 | - | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 35 | 5166121 | 5166195 | + | NZ_LT906479.1 | Serratia ficaria |
| 36 | 5402961 | 5403035 | + | NC_015567.1 | Serratia plymuthica AS9 |
| 37 | 1834638 | 1834712 | + | NZ_LR134376.1 | Aeromonas encheleia |
| 38 | 939624 | 939698 | + | NZ_CP051883.1 | Aeromonas salmonicida |
| 39 | 4615534 | 4615620 | + | NC_012880.1 | Musicola paradisiaca Ech703 |
| 40 | 4830548 | 4830634 | + | NZ_CP031560.1 | Dickeya dianthicola |
| 41 | 2169547 | 2169612 | - | NZ_CP018171.1 | Mesorhizobium oceanicum |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13407.8 | 0.62 | 24 | 3314.5 | opposite-strand | Periplasmic binding protein domain |
| 2 | PF00532.23 | 0.62 | 24 | 3314.5 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 3 | PF02653.18 | 0.62 | 24 | 2321.0 | opposite-strand | Branched-chain amino acid transport system / permease component |
| 4 | PF00005.29 | 0.74 | 29 | 811 | opposite-strand | ABC transporter |
| 5 | PF05025.15 | 0.77 | 30 | 387.5 | opposite-strand | RbsD / FucU transport protein family |
| 6 | PF02705.18 | 0.97 | 38 | -74.0 | opposite-strand | K+ potassium transporter |
| 7 | PF20030.1 | 0.92 | 36 | 1840.0 | same-strand | MoxR domain in the MoxR-vWA-beta-propeller ternary systems |
| 8 | PF07728.16 | 0.92 | 36 | 1840.0 | same-strand | AAA domain (dynein-related subfamily) |
| 9 | PF17868.3 | 0.92 | 36 | 1840.0 | same-strand | AAA lid domain |
| 10 | PF12592.10 | 0.92 | 36 | 1840.0 | same-strand | Protein of unknown function (DUF3763) |
| 11 | PF13519.8 | 0.92 | 36 | 3374.0 | same-strand | von Willebrand factor type A domain |
| 12 | PF01037.23 | 0.92 | 36 | 5925.5 | same-strand | Lrp/AsnC ligand binding domain |
| 13 | PF13412.8 | 0.92 | 36 | 5925.5 | same-strand | Winged helix-turn-helix DNA-binding |
| 14 | PF13404.8 | 0.92 | 36 | 5925.5 | same-strand | AsnC-type helix-turn-helix domain |
| 15 | PF07726.13 | 0.62 | 24 | 1873.5 | same-strand | ATPase family associated with various cellular activities (AAA) |