Result : EXP00805
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00805 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2570305 |
| Right | 2570340 |
| Strand | - |
| Nucleotide Sequence | GTGAGTCAATTCTCGCCGACACCGTCGAAGCATTAA |
| Sequence | VSQFSPTPSKH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3424225 | 3424260 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2703706 | 2703741 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2700920 | 2700955 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1009530 | 1009565 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01648.22 | 1.0 | 3 | 2708.0 | same-strand | 4'-phosphopantetheinyl transferase superfamily |
| 2 | PF03740.15 | 1.0 | 3 | 1977.0 | same-strand | Pyridoxal phosphate biosynthesis protein PdxJ |
| 3 | PF02565.17 | 1.0 | 3 | 1237.0 | same-strand | Recombination protein O C terminal |
| 4 | PF11967.10 | 1.0 | 3 | 1237.0 | same-strand | Recombination protein O N terminal |
| 5 | PF01926.25 | 1.0 | 3 | 952.0 | same-strand | 50S ribosome-binding GTPase |
| 6 | PF07650.19 | 1.0 | 3 | 320.0 | same-strand | KH domain |
| 7 | PF02421.20 | 1.0 | 3 | 320.0 | same-strand | Ferrous iron transport protein B |
| 8 | PF00009.29 | 1.0 | 3 | 952.0 | same-strand | Elongation factor Tu GTP binding domain |
| 9 | PF10662.11 | 1.0 | 3 | 320.0 | same-strand | Ethanolamine utilisation - propanediol utilisation |
| 10 | PF13401.8 | 1.0 | 3 | 320.0 | same-strand | AAA domain |
| 11 | PF14622.8 | 1.0 | 3 | -35.0 | same-strand | Ribonuclease-III-like |
| 12 | PF00636.28 | 1.0 | 3 | -35.0 | same-strand | Ribonuclease III domain |
| 13 | PF00035.28 | 1.0 | 3 | -35.0 | same-strand | Double-stranded RNA binding motif |
| 14 | PF14709.9 | 1.0 | 3 | -35.0 | same-strand | double strand RNA binding domain from DEAD END PROTEIN 1 |
| 15 | PF10502.11 | 1.0 | 3 | 594.5 | same-strand | Signal peptidase, peptidase S26 |
| 16 | PF06421.14 | 1.0 | 3 | 1584.5 | same-strand | GTP-binding protein LepA C-terminus |
| 17 | PF00679.26 | 1.0 | 3 | 1584.5 | same-strand | Elongation factor G C-terminus |
| 18 | PF03144.27 | 1.0 | 3 | 1584.5 | same-strand | Elongation factor Tu domain 2 |
| 19 | PF00071.24 | 1.0 | 3 | 1584.5 | same-strand | Ras family |
| 20 | PF04246.14 | 1.0 | 3 | 3581.5 | same-strand | Positive regulator of sigma(E), RseC/MucC |
| 21 | PF03888.16 | 1.0 | 3 | 4057.5 | same-strand | MucB/RseB N-terminal domain |
| 22 | PF17188.6 | 1.0 | 3 | 4057.5 | same-strand | MucB/RseB C-terminal domain |
| 23 | PF03872.15 | 0.67 | 2 | 5013 | same-strand | Anti sigma-E protein RseA, N-terminal domain |
| 24 | PF03873.15 | 0.67 | 2 | 5013 | same-strand | Anti sigma-E protein RseA, C-terminal domain |
++ More..