Result : EXP00804
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00804 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4350010 |
| Right | 4350078 |
| Strand | - |
| Nucleotide Sequence | TTGTTTTACTTATACCCTATCGTTAATGAATGCGCCAACTGTGATAGTGTCATCATTTTCAAAGCGTAA |
| Sequence | LFYLYPIVNECANCDSVIIFKA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4436651 | 4436719 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4451261 | 4451329 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 3879351 | 3879419 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 5292241 | 5292309 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 569326 | 569394 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 6 | 472506 | 472568 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 1096383 | 1096451 | - | NZ_CP045205.1 | Citrobacter telavivensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00892.22 | 0.83 | 5 | 3594.0 | same-strand | EamA-like transporter family |
| 2 | PF05368.15 | 1.0 | 6 | 2616 | same-strand | NmrA-like family |
| 3 | PF13460.8 | 1.0 | 6 | 2616 | same-strand | NAD(P)H-binding |
| 4 | PF01638.19 | 1.0 | 6 | 2147 | opposite-strand | HxlR-like helix-turn-helix |
| 5 | PF02872.20 | 1.0 | 6 | 86 | same-strand | 5'-nucleotidase, C-terminal domain |
| 6 | PF00149.30 | 1.0 | 6 | 86 | same-strand | Calcineurin-like phosphoesterase |
| 7 | PF00459.27 | 1.0 | 6 | 36 | opposite-strand | Inositol monophosphatase family |
| 8 | PF09695.12 | 0.83 | 5 | 1377.0 | same-strand | Bacterial protein of unknown function (YtfJ HI0045) |
| 9 | PF06526.14 | 0.83 | 5 | 2257.5 | opposite-strand | Protein of unknown function (DUF1107) |
| 10 | PF01595.22 | 0.83 | 5 | 2535.0 | same-strand | Cyclin M transmembrane N-terminal domain |
| 11 | PF03471.19 | 0.83 | 5 | 2535.0 | same-strand | Transporter associated domain |
++ More..