Result : EXP00802
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00802 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2271267 |
| Right | 2271311 |
| Strand | - |
| Nucleotide Sequence | ATGAAGAAGATGGTATCCCACACATTGGGATGGCACGCGAGGTAA |
| Sequence | MKKMVSHTLGWHAR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3111741 | 3111785 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2381093 | 2381137 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2393822 | 2393866 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1340662 | 1340706 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12697.9 | 1.0 | 3 | 3501.0 | same-strand | Alpha/beta hydrolase family |
| 2 | PF12146.10 | 1.0 | 3 | 3501.0 | same-strand | Serine aminopeptidase, S33 |
| 3 | PF16582.7 | 1.0 | 3 | 1834.0 | same-strand | Middle domain of thiamine pyrophosphate |
| 4 | PF02775.23 | 1.0 | 3 | 1834.0 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 5 | PF00425.20 | 1.0 | 3 | 450.0 | same-strand | chorismate binding enzyme |
| 6 | PF19029.2 | 1.0 | 3 | 66.0 | same-strand | DUF883 C-terminal glycine zipper region |
| 7 | PF05957.15 | 1.0 | 3 | 66.0 | same-strand | DUF883 N-terminal domain |
| 8 | PF13673.9 | 1.0 | 3 | -44.0 | same-strand | Acetyltransferase (GNAT) domain |
| 9 | PF13508.9 | 1.0 | 3 | -44.0 | same-strand | Acetyltransferase (GNAT) domain |
++ More..