Result : EXP00801
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00801 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1882145 |
| Right | 1882207 |
| Strand | - |
| Nucleotide Sequence | ATGATTTTTTTATCAGTTTTGCCGCACTTTGCGCGCTTTTCCCGTAATCGCACGGGTGGATAA |
| Sequence | MIFLSVLPHFARFSRNRTGG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1936421 | 1936483 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2538389 | 2538451 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 1900294 | 1900356 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2508070 | 2508132 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1913641 | 1913703 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 1876361 | 1876423 | - | NZ_AP014857.1 | Escherichia albertii |
| 7 | 204383 | 204439 | - | NZ_CP053015.1 | Sphingomonas lacunae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07130.14 | 0.67 | 4 | 5674 | same-strand | YebG protein |
| 2 | PF02222.24 | 0.83 | 5 | 4362.0 | opposite-strand | ATP-grasp domain |
| 3 | PF02655.16 | 0.83 | 5 | 4362.0 | opposite-strand | ATP-grasp domain |
| 4 | PF01081.21 | 0.83 | 5 | 3665.0 | same-strand | KDPG and KHG aldolase |
| 5 | PF00920.23 | 0.83 | 5 | 1817.0 | same-strand | Dehydratase family |
| 6 | PF02781.18 | 0.83 | 5 | 107.0 | same-strand | Glucose-6-phosphate dehydrogenase, C-terminal domain |
| 7 | PF00479.24 | 0.83 | 5 | 107.0 | same-strand | Glucose-6-phosphate dehydrogenase, NAD binding domain |
| 8 | PF01418.19 | 0.83 | 5 | 169.0 | opposite-strand | Helix-turn-helix domain, rpiR family |
| 9 | PF01380.24 | 0.83 | 5 | 169.0 | opposite-strand | SIS domain |
| 10 | PF00224.23 | 0.83 | 5 | 1166.0 | opposite-strand | Pyruvate kinase, barrel domain |
| 11 | PF02887.18 | 0.83 | 5 | 1166.0 | opposite-strand | Pyruvate kinase, alpha/beta domain |
| 12 | PF03279.15 | 0.83 | 5 | 2739.0 | same-strand | Bacterial lipid A biosynthesis acyltransferase |
| 13 | PF19425.1 | 0.67 | 4 | 3830 | same-strand | Csd3 second domain |
| 14 | PF01551.24 | 0.67 | 4 | 3830 | same-strand | Peptidase family M23 |
| 15 | PF04225.14 | 0.67 | 4 | 3830 | same-strand | Opacity-associated protein A LysM-like domain |
| 16 | PF08525.13 | 0.67 | 4 | 3830 | same-strand | Opacity-associated protein A N-terminal motif |
| 17 | PF01476.22 | 0.67 | 4 | 3830 | same-strand | LysM domain |
++ More..