Result : EXP00799

Protein Information

• Protein name: EXP00799
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 546845
• Right: 546916
• Strand: -
• Nucleotide Sequence: CTGTTGATGCAGCCAAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACAGAAACCCAGCAAACATTCGTAA
• Sequence: LLMQPKFVAAQKMLLKQKPSKHS
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 23

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1275103	1275168	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	1628057	1628122	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
3	37270	37335	-	NZ_CP068597.1	Paenibacillus sonchi
4	578671	578736	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
5	1221665	1221730	-	NZ_AP014857.1	Escherichia albertii

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00959.21	0.67	2	561.0	opposite-strand	Phage lysozyme
2	PF03245.15	0.67	2	103.0	opposite-strand	Bacteriophage Rz lysis protein
3	PF06291.13	0.67	2	-65.0	same-strand	Bor protein
4	PF07166.13	0.67	2	448	same-strand	Protein of unknown function (DUF1398)
5	PF07471.14	0.67	2	2098	opposite-strand	Phage DNA packaging protein Nu1
6	PF05876.14	0.67	2	2618.0	opposite-strand	Phage terminase large subunit (GpA)
7	PF00267.23	0.67	2	1399.0	same-strand	Gram-negative porin